Курс приема гормона роста: / / Manchester United Fan Zone

Содержание

Welcome

Мои мысли Welcome
Мои мысли о море

Все больше и больше я думаю о море. Не хочу сказать, что никогда там не был, просто эта тишина и спокойствие не покидают меня ни на минуту.

Мои друзья часто отдыхают на море – не видя всей прелести и не слушая его. Для них это просто развлечение и отдых. Я вижу это иначе.

Умиротворение и мысли о величии океана. Здесь я могу отказаться от повседневной суеты и полностью погрузиться в свои мысли и отдых.

Вы, наверное, смотрели фильм «Достучаться до небес»? Именно об этом я и говорю. Сценарист похож на меня, и его вдохновение возникло из ниоткуда не зря.

Томас Ян и Тиль Швайгер – талантливые люди, они понимают и верят в то, что сделали при создании этого замечательного фильма.

Посмотрите, и вы измените свое отношение к морю, океану, и вы поймете мои мысли, которые я продолжу освещать здесь чуть позже.

Продолжение следует…

My thoughts on the sea

More and more I think about the sea. I do not want to say that I have never been there, just this silence and calmness does not leave me for a moment.

My friends often rest on the sea – not seeing all the charm and do not listen to it. For them, it’s just fun and relaxation. I see it deeper.

Peace, tranquility and thoughts of the greatness of the ocean. Here I can renounce the bustle of everyday life and completely immerse myself in my thoughts and rest.

You’ve probably watched the movie Knocking on Heaven? This is exactly what I am talking about. The writer is like me and his inspiration came out of nowhere for a reason.

Thomas Jan and Til Schweiger are talented people, they understand and believe in what they did in making this wonderful film.

Try and you change your attitude to the sea, the ocean and you will understand my thoughts, which I will continue to highlight here a little later.

To be continued…

СВОЙСТВА СОМАТОТРОПИНА, ЭФФЕКТИВНОСТЬ и ПОБОЧКИ, КАК ВЫБРАТЬ ГОРМОН РОСТА, КАК ЕГО ХРАНИТЬ и ПРИНИМАТЬ, ПРИМЕРЫ КУРСОВ ГОРМОШКИ


Курс гормона роста представляет собой очень дорогой, эффективный и опасный до­пинг, хо­тя в ме­ди­цин­ских це­лях, под присмотром врачей соматотропин практически без­вре­ден. Тут бу­дет уместно вспомнить небезызвестного Парацельса, который как-то ут­вер­ждал, что все есть яд и все есть лекарство. В тоже время, очень часто говорят о том, что гор­мон рос­та вообще безвреден, но тут же рекомендуют принимать его сов­мес­тно с ин­су­ли­ном и/или гормонами щитовидной железы. Курс гормона роста, на са­мом де­ле, мо­жет при­вес­ти к диабету, к подавлению секреции гормонов щитовидки, а так же по­спо­соб­ство­вать раз­ви­тию раковых заболеваний. Мы однозначно не ре­ко­мен­дуем ис­поль­зо­вать со­ма­то­тро­пин, но, пос­коль­ку нет покоя качканутым, придется рас­смот­реть при­ем и это­го препарата.

Курс гормона роста предполагает инъекции экзогенного соматотропина, то есть мы го­во­рим не о сти­му­ля­то­рах его собственной секреции, а о введение самого гормона из­вне. Спо­со­бов про­из­вод­ства со­ма­то­тро­пи­на существует несколько, но нас, как пот­ре­би­те­лей, ин­те­ре­су­ет не то, как его производят, а то, насколько он качественный и де­ше­вый, вер­нее, нас ин­те­ре­су­ет соотношение цены и качества, о чем мы подробно по­го­во­рим да­лее. Сек­ре­цию соматотропина можно простимулировать натуральными спо­со­ба­ми и упот­реб­ле­ни­ем пеп­ти­дов, но об этом мы поговорим в отдельных статьях. В этой ста­тье мы раз­бе­рем луч­шие бренды гормона роста, способы проверки его качества, пра­ви­ла хра­не­ния, пра­ви­ла при­ема и то, каких результатов, кроме рака члена, можно ждать от кур­са со­ма­то­тро­пи­на.

Свойства соматотропина и последствия приема


Гормон роста – это полипептидный гормон передней доли гипофиза, который в под­рост­ко­вом воз­рас­те, пока не закрылись «зоны роста» костей, отвечает за их рост в дли­ну, с чем и связано его название. Так же в функции соматотропина входит сти­му­ли­ро­ва­ние син­те­за белковых структур и редукции подкожно-жировой клетчатки. Имен­но по­это­му курс гор­мо­на роста соло используют только на «сушку», а вместе с ААС и/или ин­су­ли­ном так же и для набора мышечной массы. Как вы понимаете, в плане бел­ко­во­го об­ме­на гор­мон роста и инсулин являются синергистами, оба гормона уси­ли­ва­ют син­тез бел­ка, а вот в плане углеводного обмена они являются антагонистами. Ин­су­лин сни­жа­ет уро­вень сахара в крови, а вот гормон роста его, наоборот, значительно по­вы­ша­ет. Имен­но по­это­му на длительных курсах или при превышении дозировок более 10ед в день при­ни­мать со­ма­то­тро­пин рекомендуется вместе с инсулином.

Естественная выработка гормона роста происходит по циркадным ритмам и, хотя сред­нее зна­че­ние гор­мона в крови составляет 1-5нг/мл, но во время выбросов гормона эта кон­цен­тра­ция мо­жет достигать от 10 до 40нг/мл. В среднем такие выбросы про­ис­хо­дят каж­дые 3-5 ча­сов и интенсивнее всего происходят во сне, причем через 1-2 ча­са пос­ле то­го, как человек засыпает, такой выброс происходит обязательно. Ре­гу­ли­ру­ет­ся вы­ра­бот­ка со­ма­то­тро­пи­на соматолиберином и соматостатином, первый, как сле­ду­ет из наз­ва­ния, сти­му­ли­ру­ет секрецию гормона, а второй её тормозит. Вы­ра­ба­ты­ва­ет­ся этот гор­мон гипоталамусом, а все натуральные способы повышения гор­мо­на рос­та и пеп­ти­ды дей­ству­ют по одному и тому же принципу – стимулируют вы­ра­бот­ку со­ма­то­ли­бе­ри­на ги­по­та­ла­му­сом.

Гормон роста может влиять на синтез белковых структур, как непосредственно через ре­цеп­то­ры со­ма­то­тро­пи­на, так и посредством ИФР-1. Вообще, анаболические эффекты со­ма­то­тро­пи­на свя­за­ны имен­но с ИФР-1, а вот расщепление жирных кислот происходят по дру­го­му пу­ти. На практике, все сказанное выше означает 2 факта: курс гормона роста поз­во­ля­ет од­но­вре­мен­но на­би­рать мышечную массу и сжигать жир, но это может при­вес­ти к ря­ду по­боч­ных эф­фек­тов. Выше мы их уже перечислили, но будет не лишним ска­зать о них ещё раз: во-первых, это диабет, но эту побочку можно купировать ин­су­ли­ном или диа­бе­то­ном МВ, во-вторых, это подавление секреции гормонов щи­то­вид­ной же­ле­зы, что купируется их приемом во время курса и, в третьих, развитие ра­ко­вых кле­ток, что ку­пи­ро­вать невозможно. Так же стоит заметить, что инсулин может при­вес­ти к ги­по­гли­ке­ми­чес­кой ко­ме с летальным исходом, а гормоны щитовидки окон­ча­тель­но по­да­вить сек­ре­цию соб­ствен­ных гормонов.

Во время курса соматотропина длительностью до 2х месяцев и в дозировках до 10ед в день мож­но ис­поль­зо­вать диа­бе­тон МВ, как более безопасный аналог инсулина. Что же ка­са­ет­ся Т3 и Т4, то есть, гормонов щитовидки, то при дозировках до 10ед в день и дли­тель­нос­тью кур­са до 2-3 месяцев можно обойтись и без них. А вот без андрогенных ана­бо­ли­чес­ких сте­рои­дов об­хо­дить­ся мы Вам не рекомендуем. Мы, вообще, не ре­ко­мен­ду­ем при­ни­мать ни то ни другое, поскольку любителям это не нужно, а для про­фес­сио­на­лов это прос­то не этично, но, если уж Вы качканулись настолько, что колете со­ма­то­тро­пин, тог­да будь­те так доб­ры, ставьте себе и ААС. Дело тут просто в эф­фек­тив­нос­ти, ста­вить со­ма­то­тро­пин без ААС – это, как пить водку без пива, можно, но смыс­ла нет.

Как выбрать гормон роста


На сегодняшний день рынок соматотропина в Росии заполонили гормоны роста из Ев­ро­пы, Ки­тая, а так же оте­чес­твен­ные производители. Европейские гормоны роста все очень ка­чес­твен­ные, их можно купить в аптеке, впрочем, как и ряд китайских и русских пре­па­ра­тов, но они очень дорогие. Вадим Иванов, владелец Do4a.com, провел в 2015 го­ду ана­ли­зы ря­да пре­па­ра­тов, проверив их соответствие заявленному качеству, ну а мы сис­те­ма­ти­зи­ро­ва­ли эти дан­ные и произвели на свет следующую таблицу. Но преж­де, чем пе­рей­ти к её со­дер­жа­нию, хотим обратить Ваше внимание на то, что % чис­то­ты мо­жет раз­ли­чать­ся в за­ви­си­мос­ти от того, сколько гормону роста времени. Луч­ше все­го брать пре­па­рат воз­рас­том до полугода. Дело в том, что его нужно хранить при оп­ре­де­лен­ной тем­пе­ра­ту­ре, а это часто нарушается, что и приводит к разрушению дей­ству­юще­го ве­ще­ства. В плане здоровья это не страшно, поскольку соматотропин рас­па­да­ет­ся на ами­но­кис­ло­ты, но платить бешенные деньги за белок, наверное, бес­смыс­лен­но.

Название Цена за 10Ед Страна Сертификат Проверка Чистота Фейк
Хуматроп 6000р. Франция есть есть 97-100% есть
Сайзен
3700р.
Италия есть есть 97-100% есть
Растан 3425р. Россия есть нет 94% есть
Генотропин 2300р. Бельгия есть есть 94% есть
Омнитрон 1750р. Австрия есть нет 93-95% есть
Нордитропин 1650р. Дания есть нет 96% есть
Джинтропин 1150р. Китай есть есть 95% есть
Неотропин 1000р. Китай нет нет 92% мало
Динатроп 800р. Россия нет нет 89% нет
Ансомон 600р. Китай есть есть 97% мало
Хайгетропин 450р. Китай нет нет 93% мало

Оптимальным препаратом, как показало исследование, является ансомон, поскольку его мо­гут им­пор­ти­ро­вать все дилеры без исключения. Дело в том, что в РФ нет офи­ци­аль­но­го пред­ста­ви­те­ля, поэтому каждый желающий может заказать препарат пря­мо с за­во­да. Ка­чес­тво и це­на ансомона привели к бешенному спросу на этот пре­па­рат, по­это­му он всег­да свежий, а, чем свежее гормошка, тем больше она содержит дей­ству­юще­го ве­щес­тва при про­чих равных. В общем, на момент написания статьи опти­маль­ным пре­па­ра­том яв­лял­ся ансомон, а, что колите Вы себе, люди из будущего, мы по­ка что не знаем.

Как принимать курс гормона роста


Хранение препарата: держать гормон роста следует в холодильнике, поскольку вы­со­кая тем­пе­ра­ту­ра способствует разрушению соматотропина до аминокислот.

Подготовка препарата: протрите спиртом баночку с соматотропином и ампулы с жид­кос­тью, ко­то­ры­ми Вы будете разбавлять препарат; разбавлять препарат можно бак­те­ри­цид­ной или сте­риль­ной во­дой; количество жидкости, который Вы будете раз­бав­лять гор­мон рос­та, мо­жет быть любым, все зависит от Ваших предпочтений; если Вы раз­во­ди­те 10ед со­ма­то­тро­пи­на 1мл жидкости, тогда 10 отметок на шприце типа U100 бу­дут рав­нять­ся 1ед; воду, набранную в шприц нужно смешать с порошком гормона рос­та, для это­го её че­рез шприц впрыскивают медленно в стенку баночки с со­ма­то­тро­пи­ном, что­бы во­да мед­лен­но стек­ла в порошок, после чего легкими круговыми дви­же­ни­ями смесь до­во­дит­ся до однородной массы в виде прозрачной жидкости.

Когда и куда ставить: ставить гормон роста нужно с утра перед едой, через 2 часа пос­ле еды и за пол часа до еды, во время или сразу после тренировки, на «сушке» мож­но ста­вить пе­ред сном, если Вы проснетесь ночью для того, чтобы поставить укол, то это то­же бу­дет хо­ро­шим вре­ме­нем для инъекций. Другими словами, инъекции нужно де­лать тог­да, ког­да у Вас низкий сахар в крови. Ставить препарат нужно в одно и то же вре­мя. Ста­вят гор­мон роста под кожу, чаще всего в живот, что теоретически должно спо­соб­ство­вать бо­лее быс­трой редукции подкожно-жировой клетчатки именно в этой об­лас­ти. Уко­лы ста­вят под углом в 45° и не делают их в одно и то же место.

Длительность и дозировки: длительность курса гормона роста составляет от 2 до 6 ме­ся­цев, а до­зи­ров­ки колеблются от 5 до 25ед в день; эффективные дозировки на­чи­на­ют­ся с 10ед, но их нужно начинать со 2-3 недели, при условии, что Вы себя нор­маль­но чув­ствуе­те; до­зи­ров­ки выше 10ед в день предназначены для про­фес­сио­на­лов; дли­тель­ность курса соло 2 месяца, если ставите дольше 2х месяцев, тог­да обя­за­тель­но под­клю­чай­те диабетон МВ, но длительных курсов по 4-6 месяцев луч­ше из­бе­гай­те, пос­коль­ку они могут потребовать включения инсулина.

Курс соло: предназначен для «сушки», начинается курс с 5ед в день, уколы делают 1 раз в сут­ки, ес­ли все нормально, тогда на 2-3 неделе начинают ставить 10ед в день, раз­би­вая их на два при­ема. Длительность от 2 до 6 месяцев, если курс длится больше 2х ме­ся­цев, тог­да нуж­но пить диабетон МВ, если курс длится больше 4х месяцев, тогда нуж­но пить ти­рок­син по 25мкг в сутки для защиты щитовидки. Дольше 6 ме­ся­цев инъ­ек­ции не ста­вят, пос­коль­ку это грозит забиванием рецепторов и выработки то­ле­рант­нос­ти к гор­мо­ну роста.

Курс с ААС: предназначен для «сушки», длительность курса ААС 8 недель, ставят 30мг вин­стро­ла в сут­ки, а курс соматотропина полностью повторяет курс соло.

Курс с ААС и инсулином: предназначен для набора массы, длительность курса ААС 8-12 не­дель, ста­вят, как правило, тестостерон энантатпо 500мг в неделю, можно так же до­ба­вить оксандролон по 40мг в день, курс гормошки повторяет курс соло, но так же не­об­хо­ди­мо в та­ком случае ставить 10ед короткого инсулина в сутки, ставят по 5ед че­рез час пос­ле инъекции соматотропина и после этого плотно едят.

Курс с ААС, инсулином и гормонами щитовидки: этот курс может быть на массу, мо­жет быть на суш­ку, в за­ви­си­мос­ти от того, будет ли участвовать инсулин, но этот курс прос­то дли­тель­ный, по­это­му во вре­мя него так же ставят гормоны щитовидной железы. Иног­да ста­вят по 2 кур­са ААС за цикл, а дозы гормошки доходят до 25ед в день, но это курс для тех, кто пла­ни­ру­ет занимать места на профессиональных турнирах. Так что Вам дос­та­точ­но знать, что такие курсы просто в принципе есть.

Спортивная фармакология

дозировка и схемы приема. К чему приводит избыток соматотропного гормона

Примерно в конце 80-х годов в мир профессионального железного спорта, т.е. всеми любимого бодибилдинга, пришел новый препарат – гормон роста. С тех пор произошли существенные изменения в габаритах выступающих спортсменов. Ни для кого не секрет, что в современном соревновательном бодибилдинге высокого уровня не обойтись без препаратов стероидного происхождения. Но несколько иная история с гормоном роста. Его могут позволить себе не все, т.к. он весьма дорогой. Было бы достаточно средств, или стоил бы он чуть меньше, то, думаю, большинство отдало бы предпочтение только ГР, учитывая еще тот факт, что он легален.

Хотя международный Олимпийский комитет запретил использование этого препарата спортсменами, его востребованность никак не уменьшилась. Изначально, как и большинство препаратов, соматотропин использовался исключительно в медицинских целях, но довольно быстро гормон роста начали использовать и в спорте, причем не только в бодибилдинге.

Итак, что же собой представляет этот гормон роста?. Это пептидный гормон передней доли гипофиза, который используется спортсменами для увеличения мышечной массы, придания телу рельефа.


Несмотря на то, что еще в 1989 году гормон роста был запрещен Олимпийским комитетом, сегодня его используют очень часто. Соматотропин главным образом применятся в бодибилдинге наряду с другими анаболическими препаратами для наращивания мышечной массы и уменьшения процента подкожного жира. Также гормон роста используют для снижения частоты травмирования, так как он обладает способностью укреплять костную и соединительную ткани. В других видах спорта гормон роста почти не используется, так как его прием не является целесообразным. Несмотря на то, что соматотропин увеличивает мышечные объемы, на силовых показателях это никак не отображается, то есть они не повышаются, а значит, в силовых видах спорта использовать гормон роста ни к чему. Исследования также выявили, что прием гормона роста не ведет к повышению других спортивных показателей – выносливости или производительности, поэтому соматотропин имеет смысл принимать только в бодибилдинге.

Гормон роста принимают в бодибилдинге с целью повышение рельефности. Соматотропин обладает очевидными преимуществами – высокая эффективность, малый шанс возникновения побочных явлений, отсутствие влияния на половую функцию, не требует послекурсовой терапии. После четырех недельного приема гормона роста общая масса спортсмена увеличивается незначительно (2-4кг), а в некоторых случаях может и вовсе уменьшаться из-за больших потерь жировой массы.

Главный недостаток соматотропина – очень высокая стоимость препарата и большой риск покупки подделки.

Почему гормон роста такой дорогой?

Все очень просто. Высокий спрос на данный препарат. Его используют практически везде. Их колют звездам шоу бизнеса, чтобы те выглядели моложе и красивее, колют старикам для омоложения, т.к. с возрастом секреция этого гормона уменьшается, его используют спортсмены, особенно часто в бодибилдинге. В общем, товар очень востребован. Но есть еще одна причина — процесс его производства очень сложен.

«Если гормон роста такой дорогой, то почему бы мне не купить обычный курс стероидов?» — спросите вы. А я вам отвечу. Если бы ГР не выполнял свою «работу» так, как он умеет, а именно фантастически, то его бы и не покупали, и не использовали в таком большом количестве.

  1. ГР увеличивает количество мышечных клеток. Благодаря этому эффект от курса ГР не «уходит» после его окончания, в отличие от курса стероидов.
  2. То, что практически нереально при натуральном тренинге, возможно с гормоном роста, а именно уменьшение процента подкожного жира и увеличение мышечной массы. Следует отметить, что соматотропин не рекомендован спортсменам, которым необходимо максимально развитые следующие качества: выносливость и производительность, т.к. исследованиями было доказано, что он снижает порог утомления.
  3. Гормон роста в бодибилдинге не вызывает таких побочек, как от курса стероидов. Также, курс ГР не требует ПКТ (послекурсовой терапии). Более того, ГР сможет помочь вам избавиться от «болячек», вызванных некоторыми травмами, т.к. он способен восстанавливать костную и соединительную ткань.

Как мы уже говорили, секреция гормона роста в организме человека снижается с возрастом. Минимальная выработка ГР у пожилых людей, максимален стандартный уровень — в детстве. В течение дня выделение гормона роста происходит периодически, существуют несколько пиков уровня ГР каждые 3-5 часов. Обычно самая большая секреция соматотропина происходит ночью, когда мы спим, примерно через час после засыпания.

Можно ли увеличить секрецию гормона роста? Да, можно. Вот несколько способов, как фармакологических, так и естественных.


Побочные эффекты

При приеме гормона роста побочные эффекты встречаются довольно редко, но при превышении рекомендуемых дозировок и слишком большой продолжительности курса вы можете столкнуться со следующими проблемами:

Гормон роста сегодня достаточно популярен среди профессионалов и любителей спорта. Однако, в последнее время всё чаще стали говорить о побочных действиях и опасности применения данного препарата, при этом информация достаточно противоречива. Одни специалисты считают гормон роста одним из самых эффективных средств для продления жизни, другие утверждают, что он очень вреден для нашего организма. Попробуем разобраться в этом спорном вопросе!

Механизм действия гормона роста.

Гормон роста , или соматотропин, представляет собой белок, который состоит из 191-ой аминокислоты. Выработка и секреция данного гормона происходит в передней доли гипофиза (в эндокринной железе). Кстати, из всех существующих гормонов гипофиза, гормон роста производится в наибольшем количестве, и длится этот процесс на протяжении всей жизни человека (после 20 лет продукция гормона роста начинает уменьшаться на 15% в десятилетие). Базовый уровень гормона роста достигает своего максимума в раннем детстве, а пик секреции наблюдается в подростковый период (половое созревание, интенсивный линейный рост).

Основные функции гормона роста.

Оказывая непосредственное воздействие на железы внутренней секреции, соматотропин ускоряет выработку ряда факторов роста и мышечной массы, а также активно регулирует метаболизм костной ткани человека.

Гормон роста угнетает активность ферментов , которые оказывают разрушающее действие на аминокислоты , регулирует синтез коллагена в костной ткани, коже и других тканях и органах. Вызывает увеличение размера и количества клеток щитовидной железы, надпочечников, печени, половых желёз, вилочковой железы и мышц.

Гормон роста усиливает распад жиров , в следствие чего в крови возрастает концентрация жирных кислот, которые подавляют влияние инсулина на мембранный транспорт глюкозы.

Физиологические эффекты гормона роста.

Гормон роста препятствует развитию большого количества разрушительных процессов в организме человека и стимулирует восстановительные. Многие авторитетные учёные заявляют, что под действием гормона роста происходит омоложение организма на 10-20 лет:

  • укрепляется костная система;
  • жировые отложения преобразуются в мышцы;
  • усиливается иммунитет;
  • повышаются умственные способности;
  • снижается уровень холестерина в крови;
  • увеличивается сексуальная активность.

Дозировки.

Гормон роста является сильнейшим действующим препаратом для активного роста мышечной массы и быстрого уменьшения жировых отложений. Но, чтобы достичь желаемых результатов от приёма данного препарат, обязателен ряд условий, придерживаться которых может не так много людей (достаточно жёсткий график питания, тренировок и инъекций). Итак, что представляет собой курс гормона роста? Конечно же, курс препарата и его дозировка зависят от тяжести физических нагрузок и вида спорта, к примеру, дозировки легкоатлетов достигают 8 ЕД в сутки, что является недостаточным для эффективного набора мышечной массы тяжелоатлета.

Для культуристов дозировка должна составлять не менее 12-16 ЕД, а продолжительность курса – не менее 3-х месяцев. Гормон роста рекомендовано принимать в больших дозировках по одной простой причине: рецепторы довольно быстро привыкают к препарату, поэтому колоть его долгое время не следует. После проведённого курса терапии необходим перерыв, равный длине курса.

Конечно же гормон роста не запрещается принимать на протяжении 6 месяцев и более, но исключительно в маленьких дозировках 2-4 ЕД в сутки. Однако, добиться при таком режиме гипертрофии и гиперплазии мышечных клеток почти невозможно.

Анаболический эффект гормона роста и сопутствующие препараты.

Ваша цель – это гипер рост мышечной массы. Для такого процесса Вашему организму потребуется максимальная стимуляция, и один гормон роста здесь не справится. Необходима комплексная терапия, включающая в себя препараты, способные не только усилить эффект гормона роста, но и обеспечить безопасность Вашего организма. Существует определённая схема препаратов: гормон роста — анаболические и андрогенные стероиды — инсулин — гормоны щитовидной железы. Разберём каждый препарат в отдельности.

Андрогенные стероиды обладают мощными анаболическими свойствами и значительно усиливают гипертрофию клеток мышц, поэтому их включение в комплекс обязательно. Стероиды будут также стимулировать гиперплазию клеток, что приведёт к более быстрым результатам.

Инсулин также обязательный препарат в комплексе, особенно если дозировки гормона роста действительно высоки. Инсулин облегчит нагрузки, оказываемые на поджелудочную железу, которая под действием гормона роста усиливает свою работу и достаточно быстро истощает свои запасы, а также ускорит рост клеток мышц. Рекомендуется водить инсулин по 6-8 ЕД перед каждым приёмом пищи.

Гормоны щитовидной железы способствуют ускорению метаболизма и стимуляции роста тканей. Включение в цикл гормонов щитовидной железы ослабят воздействие гормона роста на функцию железы (могут увеличиться размеры щитовидной железы). Важно знать, что использование гормона роста в больших дозировках может привести к изменениям функций щитовидной железы (развитие гипотиреоза).Спортсмены, использующие немаленькие дозировками гормона роста, должны принимать трийодтиронин (гормон щитовидной железы) по 50 мкг в сутки за два приёма. При этом большие дозировки трийодтиронина не рекомендуются, так как это будет способствовать обратному эффекту, т.е. потере мышечной массы.

С чем связаны опасения.

Гормон роста, относясь к анаболическим средствам, способствует более интенсивному протеканию обменных процессов и производству свободных радикалов в организме, что в свою очередь приводит к сокращению жизни и возникновению массы заболеваний: инфаркт, инсульт, рак и т.д.

При использовании гормона роста могут возникнуть такие побочные эффекты, как тошнота, головная боль, гипергликемия, повышение внутричерепного давления, развитие сахарного диабета, чрезмерный рост хрящевых костей, что приводит к укрупнению черт лица и увеличению нижней и верхней челюсти.

Чтобы избежать местных реакций, следует менять места подкожных инъекций, так как со временем может развиться липоатрофия — сгорание жировой ткани. При открытых зонах роста (до 25 лет) не исключён факт линейного роста тела.

В заключении.

Помните, что не следует начинать курс гормона роста без вспомогательных препаратов – иначе Вы не только не достигните желаемых результатов, но ещё и заработаете ряд хронических заболеваний. Дозировки и длительность приёма в этом случае имеют решающее значение. Поэтому, соблюдайте осторожность и доверяйте только опытным специалистам !

На спортивных ресурсах, в журналах описываются различные методики, схемы и курсы использования рекомбинантного соматотропина — Гормона роста человека. Применение данного продукта зависит от ряда факторов:

  1. возраст;
  2. исходные индивидуальные особенности человека и заболевания;
  3. цели применения гормона роста.

Изначально рекомбинантный соматропин разрабатывался для восполнения недостаточности линейного роста. Настоящий расцвет производства и разработки, а соответственно и уменьшение стоимости и улучшение качеств начались, когда продукт нашел применение в спорте.

В 2000-х активно используется широкой массой как профессионалов так и любителей. Все более часто этот продукт применяется не только в спорте: фитнесе, бодибилдинге, пауэрлифтинге благодаря своим отличным жиросжигающим и анаболическим свойствам, которые позволяют спортсменам регулировать вес тела за счет сокращения процента жировой массы и увеличения мышечного объема, силы и выносливости. Также гормон роста активно применяется в сфере посттравматического, постоперационного восстановления организма, после ожогов и других повреждений, Люди старших поколений пользуются соматотропином для препятствования возрастным изменениям в качестве омоложавающего средства. Давайте рассмотрим различные методики применения, которые применяются в большинстве случаев.

Попробуйте некитайский Джинтропин (jintropin) от официального дистрибьютора в России, рекомендуем использовать только сертифицированные лицензионные торговые марки.

Необходимо отметить, что достижение целей от применения Гормона роста — это медленный процесс. Если Вы хотите за две-три недели набрать мышечную массу, сжечь подкожный жир или восстановиться после травмы, сделав десяток инъекций, то мы будем вынуждены Вас разочаровать. Гормон является одним из самых сильных средств в своей сфере применения, обладает рядом уникальных положительных эффектов, но к применению этого продукта нужно изначально подходить как длительному процессу, курс приема составляет от двух до шести месяцев. Конечно, эффект индивидуален, зависит от множества факторов, если Вы ведете активный образ жизни, придерживаетесь диеты и занимаетесь в спортзале, применение ГР можно заметить достаточно быстро, или в антивозрастном использовании за счет контраста между изначально низким уровнем гормона роста и его повышением в крови, человек чувствует улучшение состояние за неделю-другую. Но в большинстве случаев нужно рассчитывать на то, что применение продукта должно иметь длительный характер, чтобы получить желаемые результаты.

На видео, мы рассказали, как принимать гормон роста.

  • Расчет дозировки продукта в антивозрастном применении;
  • Курс гормона роста на массу и для улучшения фигуры;
  • Курс джинтропина (гормона роста) для линейного роста и в восстановлении;
  • Какой должна выглядеть методика и программа инъекций;
  • Время, которое действует гормон роста в теле человека;

Антивозрастное применение, общее омоложение.

С возрастом выработка гормона роста у человека замедляется, если брать номинальным уровень СТГ в 25 лет, то каждые последующие 5 лет количество соматропного гормона падает примерно в 2 раза, именно низкий уровень гормона роста является одним из ключевых факторов, почему организм стареет, все хуже восстанавливается, обмен веществ замедляется, появляется склонность к травматизму и набору лишней жировой массы. Для того чтобы воспрепятствовать негативным процессам, применяют заместительные дозы синтетического рекомбинантного гормона роста. Обычно это от 1МЕ (международной единицы или ЕД — единицы действия) до 4МЕ в день. Среднее количество — 2-3ЕД считается нормальным заместительным количеством для лиц среднего и пожилого возраста, здесь нужно отметить, что количество прежде всего зависит от веса и возраста. Женщины обычно применяют не более половины от мужской дозировки — т.е. 1-2ед в день. Людям старшего возраста также не стоит завышать дозировку и начать с миниальной. Рекомендуется консультация специалиста.

Курс на массу и для улучшения фигуры

Взрослому мужчине для данных целей потребуется ежедневное количество — 4-10МЕ. Чем больше количество ГР, тем сильнее его эффект для фитнеса, поддержания фигуры и жиросжигания оптимальной цифрой будет 4-5 единиц, это же количество чаще всего выбирают те, кто впервые использует в спорте. Как пишут спортсмены, если после какого-то периода получаемого эффекта не хватает, а также если Ваша цель — прирост большого количества мышечной массы, то ежедневная дозировка может быть использована в районе 10ЕД. Как мы указывали выше для для девушки дозировка как правило существенно меньше — обычно 2-4ЕД в день.

Соматропин имеет синергитический эффект с любым спортивным питанием, а также продуктами, способствующими набору мышечной массы, для того, чтобы получить максимальный эффект от использования, рекомендуется комплексный подход, включающий в себя качественное спортивное питание, режим тренировок и отдыха.

Курс джинтропина для линейного роста и в восстановлении

Гормон роста изначально разрабатывался и применяется в терапии недостаточности линейного роста у детей. В данном случае использование, рассчет курса, методики приема должен проходить только по назначению и под контролем врача исходя из конкретной ситуации на основе анализов и состояния человека. Если Ваша цель посттравматическое воссстановление, для более эффективного использования рекомендуется консультация специалиста. Обычно применяют небольшие дозировки на протяжении нескольких месяцев.

Какой должна выглядеть методика и программа инъекций

Независимо целей применения, основное правило любой методики — начальное применение в малых и средних количествах и последующее повышение, если положительный эффект недостаточен и это необходимо. Придерживаясь данной концепции Вы сможете нивелировать или свести к минимум какие-либо побочных эффектов, таких как задержка воды, что впрочем носит скорее характер неудобств и проходит либо по мере продолжения курса либо после его отмены. Большинство людей используют ежедневное количество 5-8ЕД без какого-либо дискомфорта (а для женщин соответственно в 2 раза меньше), поэтому данная дозировка при использовании в фитнесе — лучшая начальная точка курса.

Для непрофессионалов, любителей, которые планируют применение Гормона как дополнительный источник поддержания формы, общего состояния здоровья, указанные выше дозировки будут оптимальными. Для атлетов продвинутого уровня и профессионалов указанный диапазон дозировок будет скорее всего начальным количеством.

Соматропин является полипептидом короткого действия, поэтому обычно рекомендуется делить дневное количество принимаемого продукта на две-три части, чтобы пиков концентрации в течение дня было больше и гормон роста действовал постоянно.

Ниже приведем примерную программу с повышением количества для взрослого мужчины, который ставит перед собой цели: набор сухой мышечной массы, жиросжигание и улучшение результатов в спортзале:

  • с 1 по 4 неделю = 3-4МЕ, разделить на два приема по 1,5-2МЕ;
  • с 5 по 6 неделю = 5МЕ, разделить на два приема по 2,5МЕ;
  • с 7 по 8 неделю = 6МЕ, разделить на два приема по 3МЕ;
  • с 9 по 10 неделю = 8МЕ, разделить на два приема по 4МЕ.

По этому шаблону можно продолжать далее, в конце рекомендуется снижение количества принимаемого соматропина, чтобы не было резких перепадов, особенного выхода типа послекурсовой терапии, как в случае с «химией» не требуется. Если по ходу приема Вас начнет беспокоить отечность или «туннельный синдром», когда отекают или болят пальцы на руках или ногах, а так же боли в суставах, не стоит паниковать — это нормальная реакция организма на избыток гормона роста, неприятный эффект можно убрать или максимально облегчить снизив дозировку. Попробуйте временно понизить на 25-50% дневное количество, подождите пару недель, как только дискомфорт уйдет, можно снова начинать повышение, если дискомфорт остался, понизьте еще раз принимаемое количество, в последствии можно попробовать переключиться на другую торговую марку, как показывает практика есть индивидуальная восприимчивость к тому или иному продукту. Эта методика позволит Вам сгладить или избежать возможных мелких, но тем не менее неприятных побочных явлений рекомбинантного соматропина.

Применение данного продукта обычно характеризуется длиной от 2 до 6 месяцев, Во время этого периода допускается менять торговые марки. Соматропин ставится без перерывов 7 дней в неделю.

Существуют исследования в антивозрастных группах, которые утверждают, что благодаря короткому действию, небольшой перерыв (1-2 дня) является вполне достаточным чтобы защитить соматотропную функцию гипофиза при долгосрочном применении продукта. Если Вы применяете Гормон более полугода, и он стал для Вас средством заместительной терапии, и Вы не делаете циклы приема, после которых следуют паузы, то есть смысл использовать продукт по схеме — 5 дней приема и 2 дня отдыха либо 6 дней приема и 1 день отдыха. При такой методике согласно опубликованных данных Вы сможете защитить себя от уменьшения секреции собственного гормона роста и угнетений функций организма. Встречается периодизация, основой которой является ежедневный прием на протяжении двух месяцев, в ходе которых поднимается общий уровень СТГ и ИФР-1, атлет получает максимальный анаболический эффект, после чего вместо отдыха он переходит на программу пятидневных инъекции с двухдневным перерывов, как было описано выше.

Напомним правильный метод введения, как защипывать кожу и делать инъекцию.

Как принимать гормон роста на курсе

Время эффективного воздействия гормона на организм человека

Как мы описывали в других материалах, Соматропный человеческий Гормон в организме производится не равномерно, а по синусоиде на протяжении суток. С наибольшей интенсивностью он вырабатывается в период фазы глубокого сна — первые несколько часов, после то как Вы легли спать, большое количество так же зависит от того, легли ли Вы спать согласно Вашему циклу дня и ночи для организма. Вводимый извне, с помощью инъекций «экзогенный» соматропин начинает свою работу достаточно быстро, абсорбируется тканями организма и полностью включается в работу примерно через три часа после введения, т.е. цикл действия его весьма невелик. Учитывая это целесообразно соотносить время приема продукта и дневной ритм, по которому живет Ваш организм, с учетом возрастных особенностей, а так же индивидуального режима работы и отдыха зависит от возраста и от цикла, по которому функционирует ваш организм. Строгих правил применения не существует, человек может варьировать периодизацию применения по собственному разумению и по совету специалиста исходя из индивидуальных особенностей организма и образа жизни.

У большинства людей в возрасте от 25 до 45 лет секреция своего эндогенного соматотропина находится на нормальном уровне. После того как организм произвел свою порцию гормона роста в период сна, целесообразно будет выбрать временем для инъекции утренние часы. Например, как только Вы проснулись, до или после завтрака — особого значения не имеет, конечно после завтрака организм начнет вырабатывать инсулин, который будет являться антагонистом гормона роста, но как мы писали Выше пик соматропина в крови настанет через три часа, а к тому времени, скорее всего пройдет и еще один прием пищи.

Разделите ежедневное количество вводимого продукта на 2 или 3 инъекции, существуют рекомендации, согласно которым гормон роста имеет смысл принимать в периоды максимального уровня кортизола — это раннее утро после пробуждения и в середине дня.

Если у Вас средний или пожилой возраст, или же Вы страдаете от недостаточной секреции соматропного гормона гипофизом, есть схема применения, согласно которой рекомбинантый экзогенный соматропин применяется в качестве заместителя своего эндогенного гормона роста и время для инъекции будет перед сном, соответственно, дополнительный пик будет приходится на время глубокого сна. В подобном плане организм получает гормон роста так, как будто собственный гипофиз вырабатывает его в должном количестве.

Для лиц младше среднего возраста и без проблем с уровнем собственного СТГ не имеет смысла инъекция перед сном, гипофиз сам отработает свою функцию по выработке соматропина без участия извне.

Профессиональные спортсмены используют свои методики приема гормона роста, если они параллельно применяют инсулин. Инсулин вводится так же инъекционно и подкожно сразу после тренировочной нагрузки.

Безусловно Гормон роста и инсулин в совокупности усиливают друг друга и создают максимально выгодные условия для секреции ИФР-1 в теле человека. Также дополнительным количеством инсулина спортсмены помогают поджелудочной железе на курсе гормона роста, когда активизируются весь обмен веществ в организме. Поэтому есть смысл ввести инсулин после тяжелой тренировки и тут же добавить соматропин. Важно отметить, что применение инсулина вместе с гормоном роста рекомендуется только профессионалам на серьезных дозировках соматропина — от 10ЕД в день (для женщин соответственно от 5ЕД) Если Вы являетесь любителем, если Ваша дозировка составляет менее 10МЕ в день, то совместное использование с инсулином Вам не нужно.

Гормон роста и мышечная масса | Побочные эффекты гормона роста, вред для здоровья

Как убеждают нас продавцы, соматропин для набора мышечной массы – это лучшее средство, не уступающее по своей эффективности стероидам. А выпирающие животы профессиональных атлетов, ставшие уже визитной карточкой бодибилдинга, лишь это подтверждают. Казалось бы, откуда сомнения? Стоит лишь купить гормон роста и набор массы тебе гарантирован! Однако если внимательно разобраться, то окажется, что польза от приема гормона роста для мышц весьма призрачна. А вот побочные эффекты гормона роста и вред для здоровья совершенно реальны. Помогает ли соматропин набору мышечной массы или нет, и зачем он вообще нужен, читайте в моей статье. Самое интересное о тренировках и спортивном питании на нашем канале в telegram

Вступление

Если говорить о гормонах для набора массы, то лидером в этом плане является , его авторитет в этом вопросе неоспорим. Лучшим подтверждением этому является то, что мышечная масса мужчин больше, чем у женщин, от природы, даже без тренировок. Впрочем, и те, кто применяет стероиды, могут это подтвердить с чистой совестью.

Если сравнить человека, который регулярно тренируется, но занимается без употребления тестостерона, и того, кто не занимается, но применяет анаболические стероиды, то мышечная масса будет больше именно у последнего, настолько сильным является действие тестостерона на рост мышц. Поэтому, уровень мужского полового гормона в бодибилдинге был, есть и остается краеугольным камнем, определяющим роста мышц.

ГОРМОН РОСТА и РОСТ (простите за тавтологию)

Гормон роста, он же соматропин – это пептидный гормон, который вырабатывается нашим организмом в период взросления. Именно благодаря ему мы растем, развиваемся и превращаемся из младенца весом в несколько килограммов во взрослую особь. Максимальный уровень секреции гормона соматропина отмечается в раннем детстве, пиковые значения наступают в момент полового созревания, а замедление выработки гормона роста нашим организмом начинается уже с 26 лет.

Вывод: выпирающий живот у профессионального атлета — это конечно некрасиво. Но этот и другие побочные эффекты соматропина являются справедливой платой за использование гормона роста в бодибилдинге.

ГОРМОН РОСТА и СЕРДЦЕ

Однако воздействие соматропина на внутренние органы намного опаснее выпирающего живота и постоянного храпа. Случаи возникновения тяжёлых заболеваний сердца среди профессиональных атлетов значительно участились в результате повального увлечения гормоном роста в бодибилдинге.

Лишь в прошлом году не стало двух знаменитых, знаковых, представителей бодибилдинга. В возрасте 46 лет скончался Рич Пина, а Далласу Маккарверу было и того меньше, он умер на 26 году жизни. Результаты аутопсии и того и другого, помимо заболеваний печени и щитовидной железы, выявили серьезные патологии сердечно-сосудистой системы.

Исследования, проводимые во многих странах, подтвердили, что переизбыток соматропина в организме, как раз и способствует развитию подобных заболеваний. Это и есть наихудшие побочные эффекты гормона роста. Однако есть один интересный факт…

Гормон соматропин значительно улучшает выработку коллагена. Коллаген – это фибриллярный белок, который является строительным материалом для наших костей, связок и сухожилий. Именно с этим связаны практически все результаты применения гормона роста- как позитивные, так и негативные. Худшим можно назвать действие на сердце и кровеносные сосуды. У них есть основа из коллагена, а соматропин способствует ее уплотнению.

Если уровень соматропина превышает норму, то начинается чрезмерный рост конструкций из коллагена, из-за чего сосуды становятся жёстче, проходимость крови через сердце затрудняется. При возрастных изменениях сосуды становятся более тонкими — может возникнуть геморрагический инсульт и прочие заболевания кровеносной системы. Получается, что сердцу причиняет ущерб любое отклонение от нормы уровня соматропина — как в большую, так и в меньшую стороны.

Многие бодибилдеры решают купить гормон роста, еще и потому, что он значительно укрепляет опорно-двигательную систему. Этот эффект считается позитивным для набора массы, поскольку крепкие связки и суставы позволяют работать с большими весами. Отзывы о гормоне роста спортсменов, которые опробовали его на себе, говорят о том, что мышцы на фоне его приема становятся немного больше и жёстче.

Но это происходит не за счет гипертрофии мышечных волокон. Фасции-оболочки, в которые они упакованы делаются просто плотнее, немного увеличиваясь в объёме. Но вот на рост мышц это никакого влияния не оказывает.

Бывает, что во время тренировок случаются ошибки или же тело не справляется с заданным уровнем нагрузки. В таком случае, соматропин имеет положительное действие — с его помощью повреждения мышц и связок заживают быстрее. Но чтобы избежать таких проблем, достаточно правильно планировать тренировки. Ибо при занятиях силовым спортом недоработка лучше, чем переработка.

Вывод: способность гормона роста увеличивать выработку коллагена благотворно влияет на опорно-двигательную систему. Но повышает, особенно в зрелом возрасте, риск возникновения проблем с сердцем.

ГОРМОН РОСТА В БОДИБИЛДИНГЕ

Использование соматропина практикуется уже достаточно давно, его свойства изучены в полной мере. Производство препаратов с его содержанием было налажено ещё в советские времена. Если бы гормон роста для мышц и вправду был так же хорош, как и анаболические стероиды, то он и применялся бы с ними наравне. Тем не менее этого не произошло.

Были единичные случаи использования гормона роста бодибилдерами в Советском Союзе, но исключительно в целях повышения мышечной жесткости. А некоторые спортсмены, особенно тяжелоатлеты, использовали гормон соматропин для быстрого заживания повреждений, полученных во время работы с запредельными весами. В этом случае применение подобного препарата было оправдано.

Но вот ураганного роста мышц ни у кого от соматропина не было. Это при том, что добывали его в те времена из гипофиза покойников, то есть был он натуральным, а не искусственным, то есть более действенным. Тот факт, что тогда никто не использовал соматропин для набора массы, свидетельствует о его бесполезности в этом качестве.

Что касается стероидов, то они были необыкновенно популярны среди бодибилдеров в ту пору. И хотя купить гормон роста в аптеке можно было наравне с анаболическим стероидами свободно и даже без рецепта, но те, кто хотел набрать массу, останавливали свой выбор именно на стероидах. И так продолжалось вплоть до начала этого века.

Вывод: гормон роста для мышц бесполезен. Соматропин в бодибилдинге имеет смысл использовать лишь, как средство для заживления и восстановления после травм.

КУПИТЬ ГОРМОН РОСТА – НЕ ЗНАЧИТ НАБРАТЬ МАССУ

Китайские учёные в двухтысячные годы изобрели способ производства рекомбинантных (искусственных) белков. Так на гормоне роста стали делать бизнес — в частном порядке налаживали производство, поскольку это не требовало больших финансовых затрат, и выставляли его на продажу.

А поскольку реклама – это лучший двигатель торговли, то массированная и хорошо финансируемая информационная волна накрыла весь мир. Миф, утверждающие, что купить гормон роста – это значит со 100% гарантией набрать массу, причем «сухую», без жира, был возведен в ранг абсолютной истины.

Но к популяризации гормона роста в бодибилдинге приложили руку и спортивные журналы, издаваемые на просторах СНГ. И это не случайно, ибо одно из российских изданий по силовому спорту, активно рекламирующее соматропин, было одновременно официальным экспортёром из Китая искусственного гормона роста.

Гормон роста: результаты до и после

Как быстро я увижу результаты от гормона роста? Это основной вопрос, спортсменов и обычных людей, употребляющих данный препарат. Давайте разберемся, какие эффекты наступают от применения гормона роста, и в какой срок. Для этого мы рассмотрим результаты использования от 2 недель до 6 месяцев.

Сколько займет времени, чтобы увидеть результаты от гормона роста?

На этот вопрос нельзя ответить однозначно. Это объясняется тем, что каждый человек индивидуален, у всех разный возраст, восстановительные способности организма, предрасположенность к данному препарату и так далее…Так одни замечают эффект от гормона роста, уже через одну неделю после употребления, а другим надо не менее 2-3 недель, чтобы почувствовать хоть какие-нибудь результаты. Также важную роль играет дозировка гормона роста. Но все же, не рекомендуется превышать оптимальное количество действующего вещества на ваш вес, ради более быстрого прогресса. Постараемся отследить, какие же эффекты оказывает гормон роста на среднестатистического человека, в конкретный промежуток времени.

Гормон роста результаты после 1 месяца

Как только, в ваш организм попадает гормон роста, в нём сразу начинают происходить изменения. В течении первых нескольких недель они будут видны через увеличение энергии и жизненной силы, которая в свою очередь может привести к повышению производительности. Ваши тренировки в зале будут проходить на 1 дыхании, усталость практически не будет ощущаться. Появится стойкое ощущение, что вы способны сделать узел на тренировочном грифе. Наконец, многие пользователи гормона роста сообщают, что улучшается их настроение, а депрессия уходит.

Гормон роста результаты после 2 месяцев

Через 2 месяца, после начала приема гормона роста, результаты уже будут более заметны. Это проявляется в улучшении состояния кожи и улучшения тонусы мускулатуры, так как гормон роста помогает организму регенерировать клетки быстрее. Благодаря этому, укрепляются даже мышцы глаз. Это будет проявляться в улучшении вашего зрения и ночного видения. Обмен веществ тоже не стоит на месте, и через 2 месяца после курса гормона роста, ускоряется. В результате этого — вы увидите первые потери жира.

Гормон роста результаты после 3 месяцев

Этот месяц является еще одной важной вехой. После 3 месячного курса гормона роста, мы можем видеть первые улучшения вида и состояния волос. Ваши кости начнут становиться сильнее и прочнее, и хотя вы вряд ли этот эффект можно почувствовать, вы скорее всего заметите большую гибкость в суставах, и уменьшение боли в них. Женский пол в свою очередь, может избавиться от плохих симптомов ПМС, которые возникают с возрастом.

Гормон роста результаты после 4 месяцев

Последствия применения гормона роста до и после, становятся все более заметными и очевидными в течении 3-4 месяца, после начала курса. Также продолжают совершенствоваться в положительную сторону результаты, влияющие на настроение, энергию, выносливость, состояние кожи и волос. А скорость метаболизма возвращается к своему «молодому» темпу. Вы увидите постепенную потерю жира и увеличение мышечной массы, особенно если при этом тренируетесь в тренажерном зале.

Гормон роста результаты после 5 месяцев

Через 5 месяцев, после начала курса гормона роста, вы захотите делать фотографии, чтобы наглядно демонстрировать себе и окружающим, свой прогресс. Вы заметите, хорошо видимые улучшения в состоянии волос. Они станут толще, намного эластичнее и блестящими. Кроме того, обесцвечивание кожи, что является одним из признаков старения, намного уменьшится. Через 5 месяцев — преображение организма, будет хорошо видно невооруженным глазом, внешний вид значительно улучшится.

Гормон роста результаты после 6 месяцев

  • Сон станет лучше и намного глубже
  • Кожа — гладкая и упругая, обретет более молодой вид
  • Ускорение метаболизма
  • Улучшение иммунитета и сердечно — сосудистой системы
  • Увеличение энергии, выносливости, силы.

Благодаря улучшению метаболизма и способности гормона роста влиять на рост мышц, после шести месячного курса вы увидите чудесные эффекты, относящиеся к вашей фигуре. Помимо потери жира и роста мышц, гормон роста уменьшает целлюлит и помогает телу быстрее приобрести хорошие пропорции. Вы станете более успешным в спорте, результаты будут намного выше, чем раньше, вы легко сможете переносить длительные физические нагрузки, благодаря увеличению выносливости, силы мышц и повышению прочности костей.

Гормон роста ДО и ПОСЛЕ

Так на что же влияет гормон роста, и какие его эффекты? Гормон роста способен поменять вашу внешность и жизнь к лучшему, он влияет на все, от сна и настроения до волос и состояния кожи. Давайте рассмотрим основные сферы воздействия гормона роста.

Внешний вид

До — поседение и сухость волос. Морщины и обесцвечивание кожи.

После — толстые и здоровые волосы, имеющие характерный блеск. Возможно станет меньше седых волос или даже восстановится их первоначальный цвет, кожа станет гладкая и более упругая, улучшится её тонус.

Физическая форма

До — присутствует лишний вес. Не правильное соотношение жира и мышц в организме. Плохой мышечный тонус.

После — отличные пропорции, компактное и более мускулистое тело, большие потери жира.

Физические способности

До — низкая выносливость и прочность суставов. Ухудшение зрения, особенно в темноте.

После — повышенная выносливость и способность выполнять интенсивные физические упражнения, улучшение результатов в спорте, зрение также улучшается.

Общее состояние

До — плохой сон, низкая энергия и снижение настроения, плохая концентрация и производительность.

После — глубокий и здоровый сон, подъем жизненных сил, стабильное оптимистическое настроение, повышенная умственная способность и производительность.

Если вы хотите улучшить свое общее самочувствие, а также избавиться от нескольких ненавистных килограмм жира, набрав при этом мышечную массу, то гормон роста как нельзя кстати подойдет для этих целей. Перед применением обязательно проконсультируйтесь со специалистами, чтобы ваш курс прошел максимально эффективно.

Как нарастить мышечную массу быстро и качественно?

13 июля 2017

Многие спортсмены во время наращивания мышечной массы слышат о таком препарате, как гормон роста. Соматотропин относится к гормонам пептидной группы, производится долей гипофиза, который входит в состав человеческого мозга. Вещество оказывает сильнодействующее анаболическое воздействие на организм, при этом также имеет катаболическую реакцию, то есть сжигает лишний жир.

Эффекты от приема гормона роста на курсе наращивания

В бодибилдинге данное вещество имеет важное значение, поскольку ему свойственно оказывать на человека такие эффекты:

1. Стимуляция увеличения мышечной массы.
2. Снижение жировой прослойки под кожей.
3. Омолаживает организм и кожу спортсмена.
4. Быстро заживляет раны и восстанавливает минимальные повреждения.
5. Укрепляет кости и связки.
6. Повышает иммунную систему и уравновешивает обмен веществ.
7. Оказывает восстанавливающее действие на внутренние органы.

Важно помнить о том, что основной толк для повышения мышечной массы оказывает соматотропин в комплексе с другими средствами для наращивания, но многие спортсмены предпочитают использовать только гормон роста из-за его свободной продажи и доступности.

На практике стало ясно, что если до применения у спортсмена были хорошие пропорции тела и неплохая мышечная масса, то после эксплуатации гормона роста данные показатели улучшились в 2-5 раз. К улучшениям относят: просушку мускулатуры, прорисованные мышцы и повышенную венозность. А если говорить о безопасной дозировке соматотропина, то она располагается в пределах 30 МЕ. В зависимости от действия препарата дневной прием может варьироваться в пределах от 2 до 30 МЕ. Эту дозу превышать не стоит, а лучше консультироваться с врачом, чтобы не получить побочные эффекты.

Введение соматотропина внутривенно важно делать 1 раз в 2 дня. Это нужно для того, чтобы не сбивалась выработка организмом естественного гормона. Если проводить инъекции ежесуточно, то важно имитировать естественное производство гормона. Для этого нужно вводить около 5 МЕ каждые 4 часа. Гормон роста купить: http://www.hulk.in.ua/c15-gormony-rosta/ можно в любом интернет-магазине без рецепта, так как он не является запрещенным к использованию.

Как питаться на курсе приема?

Для наращивания приличного объема мышечной массы не хватит только силовых нагрузок и инъекций гормона роста. Для достижения отличной формы необходимо еще и правильное питание, в таком случае рельефная мускулатура появится очень быстро. В рацион питания должно входить мясо, каши, салаты, молочные продукты. Также не стоит забывать об использовании овощей и фруктов. Важно, чтобы питание состояло из белков, при этом необходимо по максимуму исключить белки и жиры. Именно они придадут мускулатуре раздутый вид и добавят жира.

С самого начала наращивания мышечной массы из рациона важно удалить копчености, соленые продукты, пирожные, булочки, торты, жирную пищу, шоколад, мороженое, газировку и алкоголь. Также не рекомендуется использовать полуфабрикаты и соки, которые прошли термическую обработку. Лучше всего использовать свежие овощи и фрукты, которые добавят вашему организму максимум полезных витаминов. Также время наращивания мышечной массы не стоит забывать о приеме специальных витаминных комплексов, которые добавят вам сил и полезных веществ.

Если вы решили наращивать мышечную массу, при этом использовать гормон роста, то перед его приемом проконсультируйтесь с доктором относительно дозировки.

Биохакеры верят, что гормоны продлевают молодость. Что говорит наука?

Гормоны — лучшие друзья биохакеров. Например, предприниматель Сергей Фаге, самый известный российский биохакер, колет себе гормон роста соматропин, пьет микродозы гормонов щитовидки и блокирует у себя рецепторы к эстрогену, чтобы «повысить выработку тестостерона». Безопасно ли это? Об этом нашим друзьям из издания Reminder рассказала эндокринолог, автор телеграм-канала «Эндоновости» Евдокия Цветкова.

Anastasia Dulgier / Unsplash

Откуда берутся гормоны и «гормональные сбои»

Организм человека представляет собой огромный завод с миллиардами клеток, которые производят гормоны. Каждый выделяемый гормон работает не на одной должности — он играет разные роли в разных частях организма. Взять для примера инсулин: он увеличивает проникновение глюкозы в клетки, в печени и мышцах стимулирует образование гликогена из глюкозы, усиливает синтез жиров и белков, способствует транспорту ионов калия в клетки, подавляет активность ферментов, расщепляющих гликоген и жиры, и так далее. Именно поэтому гормональное самолечение так опасно — последствия могут коснуться большого количества систем и органов. 

Процесс гормональной регуляции можно назвать гормональными качелями, на них мы мягко покачиваемся большую часть нашей жизни. У секреции гормонов в кровь есть пики и спады, которые повторяются изо дня в день с небольшими вариациями. Все потому, что физиологические процессы в организме человека синхронизированы с вращением Земли вокруг своей оси — это называется циркадианными ритмами. Например, с утра у здорового человека наблюдается пик выработки глюкокортикостероида кортизола — это помогает проснуться, взбодриться и начать новый день. К вечеру выработка кортизола снижается — пора расслабляться и готовиться ко сну. Подобная система гормональной регуляции называется импульсной секрецией. Такие «гормональный качели» — динамическая саморегулирующаяся система, и если все в порядке, то гормонов вырабатывается столько, сколько нужно организму.

Но что, если гормонов вырабатывается недостаточно или избыточно? Могут быть две причины.

Возможно, где-то в эндокринной системе произошла «поломка» — и тогда развивается эндокринное заболевание. Но помимо заболеваний есть и некоторые состояния, при которых количество гормонов также изменяется. Одно из них — это старение, процесс, который происходит со всеми нами постоянно, с момента рождения. Влиять на гормоны старение начинает почти сразу после выхода из пубертата: после периода подросткового «гормонального всплеска» и относительно недолгой стабилизации секреция гормонов постепенно начинает снижаться. Особенно активно с возрастом падает синтез половых гормонов, гормона роста и мелатонина. В связи с этим появилось новое медицинское направление — антиэйдж-медицина, в арсенале которой среди прочего есть и гормональная терапия. 

Гормональная терапия в целом — это прием синтетических гормонов для лечения или профилактики каких-либо заболеваний, а также, например, для контрацепции. В частности, гормональная терапия может применяться, когда собственные клетки организма вырабатывают недостаточно гормонов — и их нехватку нужно восполнить с помощью приема препаратов.

Гормоны — это вещества, которые вырабатываются в эндокринных железах, или железах внутренней секреции. К эндокринным железам относятся щитовидная и поджелудочная железы, надпочечники, половые железы — яички или яичники, паращитовидные железы, а также определенные зоны в мозге — эпифиз и гипоталамо-гипофизарный комплекс.

Но и это еще не все. По всему организму распределены многочисленные специализированные клетки, вырабатывающие гормоны, — апудоциты. Они захватывают аминокислоты и производят из них некоторые гормоны — в частности, адреналин, норадреналин, дофамин и серотонин. Сейчас идентифицировано более 60 типов таких клеток, они располагаются в самых разных органах и тканях — в том числе в желудочно-кишечном тракте, органах мочевыводящей и дыхательной систем, коже и жировой ткани.

Как гормоны стали применять для продления молодости

Идеи продления жизни и молодости с помощью гормонов — а именно пересадки половых желез — появились еще на заре развития эндокринологии как науки.

Сначала немецкий физиолог Адольф Бертольд в 1849 году заметил, что при пересадке кастрированному петуху в брюшную полость семенников другого петуха у первого исчезают все внешние последствия кастрации: восстанавливаются пропавшие пышный гребень и бородка, вновь встает поникший веер хвостовых перьев (тогда как обычно кастрированный петух со временем внешне становится все более похожим на курицу).

Спустя сорок лет, в 1889 году, на заседании Парижского биологического общества профессор экспериментальной биологии Шарль Броун-Секар выступил с ошеломляющим сообщением об опытах, проведенных на самом себе. Семидесятидвухлетний ученый вводил себе вытяжки из семенных желез животных — и установил, что они оказывают на стареющий организм «омолаживающее» действие. У него возникало ощущение необыкновенной бодрости, повышались работоспособность, мышечная сила и либидо. Экстракты из семенников Броун-Секар назвал «эликсиром молодости». Пресса подняла огромный шум вокруг этого события, в аптеках стали продавать «Броун-Секаровскую жидкость», за которой выстраивались очереди из жаждущих омоложения. Увы, Броун-Секару не удалось избавить мир от старости: омолаживающий эффект оказался кратковременным, а через два-три месяца возрастные изменения даже прогрессировали. Тем не менее это было первым шагом к современной антиэйдж-медицине и гормональной терапии.

Свое новое рождение антиэйдж-медицина, или медицина активного долголетия, пережила сравнительно недавно. В 1993 году остеопаты Роберт М. Голдман и Рональд Клатц основали Американскую академию антиэйдж-медицины (American Academy of Anti-Aging Medicine), сертифицирующую специалистов в области активного долголетия. Антивозрастная медицина стремится достигать и поддерживать хорошее состояния здоровья независимо от хронологического возраста. Прекрасно звучит, не правда ли?

Ведь если естественные механизмы старения могут [1, 2] приводить к развитию заболеваний (сердечно-сосудистых, онкологических, костно-суставных, нейродегенеративных и сахарного диабета), то не правильно ли было бы всеми силами и достижениями науки его — старение — предотвращать? Это, безусловно, так.

Но стоит заметить, что далеко не все идеи Американской академии антиэйдж-медицины соответствуют положениям доказательной медицины: в частности, спорны и небезопасны попытки применения с антиэйдж-целями гормона роста, ряда антиоксидантов, а также половых гормонов без учета показаний и противопоказаний. Американская медицинская ассоциация не признает данную организацию вовсе. Ученые, длительно занимающиеся вопросами старения, уже выступали с критикой антиэйдж-медицины, противопоставляя ей геронтологию — науку, изучающую биологические, социальные и психологические аспекты старения человека, его причины и способы борьбы с ним. То есть делающую все то же самое, но используя только методы с доказанной научной эффективностью и безопасностью.

Мы сфокусируемся на тех методах антивозрастной гормональной терапии, которые находятся на пересечении антиэйдж-медицины и геронтологии — и имеют под собой доказательную базу.

Чем отличается гормональный препарат, синтезированный в лаборатории, от гормона, который производит наш организм?

Большинство гормонов, применяемых в медицинской практике, отличаются от тех, что синтезирует наш организм, или эндогенных гормонов.

Различие чаще всего состоит в том, что в искусственно синтезированном препарате есть дополнительные молекулы, которые могут:

  • продлевать действие препарата по сравнению с эндогенным гормоном, тем самым удлиняя промежуток между его приемом/инъекциями для большего комфорта человека;
  • ускорять/усиливать действие препарата по сравнению с эндогенным гормоном, тем самым сокращая период ожидания эффекта, снижая необходимую для достижения нужного эффекта дозу;
  • увеличивать селективность препарата, тем самым снижая вероятность побочных эффектов.

Кроме того, лекарства, содержащие гормоны, имеют вспомогательные вещества, обеспечивающие определенный способ доставки: подкожные инъекции, гели, кремы, пластыри. 

В некоторых случаях гормональные препараты могут даже иметь преимущество по сравнению с гормонами нашего организма. В частности, оральные контрацептивы, содержащие дросперинон — синтетический аналог гормона прогестерона, — используются в лечении предменструального синдрома, который может развиться на фоне естественных колебаний эстрогенов и прогестерона в организме.

Менопаузальная гормональная терапия (МГТ)

Эстрогены и прогестагены, так называемые «женские» половые гормоны, есть у всех людей, просто у женщин их содержание в организме больше, чем у мужчин. Уровень половых гормонов колеблется на протяжении всей жизни человека. Факторы, которые могут влиять на уровень женских половых гормонов, включают в себя возраст, фазу менструального цикла, беременность, стресс, прием лекарственных препаратов, окружающую обстановку и менопаузу.

«Женские» половые гормоны участвуют в половом созревании и половом развитии, защитных воспалительных реакциях организма, влияют на возможность забеременеть, сексуальное желание, регулируют рост костей и мышц, уровень холестерина, распределение жира в организме, стимулируют рост волос.

После пика секреции половых гормонов в пубертате — с 8–10 до 13–15 лет — уровень «женских» гормонов стабилизируется, наступает плато. Потом, в перименопаузу — 41–51 год, — секреция эстрогенов и прогестерона начинает снижаться. Резкое снижение происходит в менопаузу и постменопаузу (45–65 лет), и уровень остается стабильно низким после 65 лет.

Если менструации прекращаются в возрасте до 40 лет, то говорят о преждевременной менопаузе, до 45 — о ранней. Какой-то серьезной профилактики ранней менопаузы, к сожалению, не существует. Ведь одной из ее причин является генетическая предрасположенность: если у мамы и бабушки женщины была ранняя менопауза, то, скорее всего, у нее она тоже будет. Но сейчас появляется информация, что некоторые изменения в питании могут слегка отсрочить наступление менопаузы: высокое употребление жирной рыбы — на 3,3 года, бобовых — примерно на год. А вот злоупотребление рафинированной пастой и рисом, напротив, может приблизить менопаузу на 1,5 года.

Какие симптомы помогут заподозрить, что у вас снизился уровень «женских» половых гормонов?

  • Вы заметили нарушение менструального цикла.
  • У вас появились приливы жара, перемежающиеся с ознобом, и сильная потливость.
  • Вы страдаете перепадами настроения, появилась депрессия.
  • Появились или усилились боли в суставах и мышцах.
  • Вы заметили сухость во влагалище и боль или дискомфорт при занятии сексом.
  • У вас снизилось либидо.
  • У вас участились мочевые инфекции, такие как цистит.

Начало МГТ должно укладываться в «терапевтическое окно» — не более 10 лет с окончания менструаций. Поэтому стоит внимательно отслеживать свой цикл — и когда (как правило, в возрасте старше 40 лет) он становится сильно нерегулярным или менструации не приходят более полугода, имеет смысл обратиться к гинекологу-эндокринологу для подтверждения начала менопаузы. Для этого сдается гормональный анализ крови — на эстрадиол и фолликулостимулирующий гормон. Сейчас в продаже также появляются экспресс-тесты на менопаузу, аналогичные экспресс-тестам на беременность. 

Низкий уровень эстрогенов — это серьезный риск для здоровья. Он вызывает потерю минеральной плотности костной ткани — это может привести к остеопорозу и переломам костей, в том числе шейки бедренной кости, что может инвалидизировать женщину. Менопаузальные гормональные изменения также могут увеличить риск сердечных заболеваний и инсульта.

Однако жизнь женщины не прекращается с окончанием репродуктивного периода. За счет увеличения продолжительности жизни целая треть жизни современной женщины приходится на менопаузу. И если менопауза ухудшает качество этой жизни, то менопаузальная гормональная терапия (МГТ) является выходом.

Возможные бонусы правильно подобранной МГТ:

  • снижение риска инфаркта миокарда, сердечно-сосудистых заболеваний, сахарного диабета 2-го типа, профилактика атеросклероза;
  • уменьшение риска преждевременной смерти;
  • ослабление климактерических и урогенитальных проявлений;
  • профилактика остеопоротических переломов;
  • ремиссия депрессии;
  • снижение риска болезни Альцгеймера и деменции;
  • улучшение качества ночного сна;
  • улучшение качества сексуальной жизни;
  • регресс старения кожи;
  • уменьшение костно-суставных болей, улучшение гибкости суставов и эластичности связок.

И за счет всего вышеперечисленного — существенное улучшение качества жизни и увеличение ее продолжительности. 

На фоне некоторых препаратов, используемых для МГТ, могут повышаться риски рака эндометрия и молочных желез. Поэтому важно принимать гормональную терапию только по показаниям, подбирать препараты вместе с врачом — и получать минимальную эффективную дозу гормонов. А еще, пока вы принимаете МГТ, раз в год посещать врача для обследования. Чтобы риски были минимальны, терапия должна стать частью общей стратегии, включающей здоровое питание — меньше красного и обработанного мяса, сладостей, больше рыбы — не менее 150 минут физической нагрузки в неделю, отказ от курения и употребления алкоголя.

Не только у женщин, но и у мужчин может быть недостаток прогестерона и эстрогенов.

Дефицит эстрогенов в мужском организме пока слабо изучен и, как правило, связан с определенными генетическими «поломками». В настоящее время эстрогены мужчинам не назначаются, за исключением лечения редких заболеваний, таких как врожденный дефицит эстрогена.

Недостаток прогестерона у мужчин чаще всего развивается во время андропаузы — это аналог менопаузы у мужчин. Это происходит за счет того, что меняется соотношение тестостерона и эстрогенов — и из-за этого блокируется синтез прогестерона. В таком случае решается вопрос о гормональной терапии тестостероном.

Андропаузальная гормональная терапия (АГТ)

Тестостерон относится к группе гормонов, которые есть у всех, но у мужчин они вырабатываются в большем количестве — из-за этого их называют андрогенами, или «мужскими» половыми гормонами.

У андрогенов много функций: они стимулируют обмен веществ, обновление клеток, рост мышц, повышают минеральную плотность костей. Они влияют и на более очевидные вещи: размер наружных половых органов (как полового члена и яичек, так и, например, клитора), синтез спермы, тембр голоса, рост волос на лице и в определенных зонах тела. Кроме того, эти гормоны влияют на формирование условно мужской конституции тела — это бо́льшая длина рук по отношению к длине ног, более широкая грудная клетка и узкий таз, характерное распределение жира и мышц.

В период полового созревания у мальчиков уровень тестостерона значительно увеличивается, а после тридцати лет начинает постепенно (на 1–2% в год) снижаться. В 55–60 лет его становится уже на 20–25% меньше, и наступает так называемая андропауза — с этого момента низкий тестостерон принято считать нормой. Правда, в отличие от женщин в постменопаузе, созревание половых клеток у мужчин после андропаузы не прекращается.

Недостаток тестостерона у мужчин называют термином «гипогонадизм». В трудоспособном возрасте он встречается, по разным данным, с частотой от 8,6 до 38,7%. Причины могут быть самыми разными — например, работа клеток Лейдига, синтезирующих этот гормон, может нарушиться при травме, инфекции, воздействии облучения или химиотерапии, при опухолях яичек, некоторых других заболеваниях. Есть болезни и лекарства, которые нарушают работу гипоталамуса или гипофиза, которые, в свою очередь, перестают стимулировать выработку андрогенов.

Дефицит тестостерона у мужчины может несколько напоминать состояние менопаузы.

Как заподозрить у себя дефицит тестостерона?

  • Уменьшается количество волос на теле и лице.
  • Вы начинаете терять мышечную массу.
  • Снижается либидо, может появиться эректильная дисфункция.
  • Уменьшается количество сперматозоидов, и в связи с этим может развиться бесплодие.
  • Увеличивается грудь по «женскому» типу.
  • Появляются приливы жара.
  • Вы становитесь раздражительным, легко теряете концентрацию, можете даже впасть в депрессию.

Если у вас появляются подобные симптомы, можно сдать анализ крови на общий тестостерон и обратиться к эндокринологу. Регулярно проверять уровень тестостерона «на всякий случай» не требуется. 

Как таковой профилактики возрастного гипогонадизма не существует, однако можно влиять на один фактор риска — на жировую массу. В жировой ткани тестостерон превращается в эстрогены, соответственно, больше жировой ткани — больше эстрогенов и меньше тестостерона. Чтобы этого не происходило, имеет смысл поддерживать стабильную массу тела в пределах здорового ИМТ.

Андропауза, или возрастной гипогонадизм, считается естественным процессом, но она может влиять на качество жизни. Поэтому сейчас активно обсуждается гормональная терапия возрастных изменений у мужчин. Задумываться о ней российским мужчинам имеет смысл примерно в 50–55 лет — конечно, если симптомы гипогонадизма не начали появляться в более раннем возрасте.

Андропаузальная гормональная терапия — это не всегда безопасно: тестостерон не должны получать, например, пациенты с некоторыми заболеваниями простаты, сердечной недостаточностью и обструктивным апноэ сна. В 2013–2014 годах сообщили о связи между такой терапией и увеличением числа случаев инфаркта миокарда и инсульта, и FDA выпустило предостерегающий бюллетень.

Возможные бонусы правильно подобранной АГТ:

  • повышение либидо, более частые и длительные эрекции;
  • увеличение мышечной массы и силы;
  • уменьшение объема жировой ткани;
  • нормализация артериального давления и показателей холестерина;
  • усиление бодрости.

У женщин тоже бывает дефицит тестостерона, например, при заболеваниях гипофиза или надпочечников. При этом отмечается снижение либидо, сухость влагалища, нарушения внимания или даже депрессия. Также может развиться остеопороз и нарушения менструального цикла. Официальное показание к назначению тестостерона у женщин — это гипоактивное расстройство полового влечения, при котором у женщины снижается интерес к сексу.

Проводились исследования, которые показали неплохую эффективность местного применения тестостерона при вульвовагинальной атрофии в менопаузе, но пока такое лечение не является стандартным.

Мелатонин: ключ к продолжительной жизни?

Мелатонин, так называемый «гормон сна», не просто помогает нам уснуть — это важный для организма гормон, который обладает особыми антиоксидантными свойствами. У человека секреция мелатонина происходит как в апудоцитах по всему организму, так и в мозге, в специальной эндокринной железе — эпифизе.

Синтез мелатонина контролируется солнечным светом. Именно он является тем веществом, которое синхронизирует биологические день и ночь с днем и ночью окружающей нас среды — хронобиотиком.

Выработка мелатонина происходит исключительно в темное время суток. При искусственном освещении в ночное время синтез мелатонина тормозится. У вас может нарушиться выработка мелатонина, если в вечернее время вы смотрите на источники синего света (460–480 нм) интенсивностью от 60 до 130 люкс — например, на экраны ноутбуков или смартфонов.

Мелатонин не только реализует важные для организма функции антиоксиданта и хронобиотика, но и оказывает влияние на углеводный обмен, секрецию инсулина, гормонов жировой ткани (лептина, адипонектина) и пищевое поведение. Благодаря своим свойствам мелатонин регулирует метаболизм практически в каждом типе клеток.

Почему может развиваться недостаток мелатонина? Тому может быть множество причин: уже упомянутое избыточное освещение в ночное время, сменный график работы, облучение области эпифиза и т.д. Но одной из причин также являются возрастные изменения организма.

После пика в препубертате уровень мелатонина снижается до стабильного «взрослого» уровня — именно тогда у человека должны стабилизироваться его «биологические часы». Мелатонин вырабатывается в нужном количестве и в нужное время, человек начинает ложиться и вставать примерно в одно и то же время — в соответствии со своим хронотипом (если, конечно, ему не мешают внешние обстоятельства вроде графика работы).

Но у людей старше 25–40 лет выработка мелатонина эпифизом снижается — примерно до 60% от «взрослого» уровня. С этого момента происходит постоянное снижение уровня гормона, вплоть до 20% от «взрослого» уровня к 90 годам.

Как понять, что уровень мелатонина у вас может быть снижен?

  • Вы с трудом засыпаете по ночам, часто чувствуете слабость, усталость, сонливость в дневные часы. 
  • У вас увеличивается аппетит.
  • Появляются или обостряются расстройства пищевого поведения

В такой ситуации необходимо обратиться ко врачу — сомнологу или эндокринологу, который уже порекомендует необходимые исследования.

Пониженный мелатонин может снижать качество жизни, к тому же это один из факторов риска преждевременной смерти. Нехватка мелатонина может приводить к расстройству сна, повышению риска сахарного диабета 2-го типа и онкологических заболеваний, главным образом — рака молочной железы и простаты.

Некоторые из этих проявлений можно устранить с помощью терапии мелатонином.

Возможные бонусы правильно подобранной терапии мелатонином:

  • улучшение количества и качества сна;
  • антиоксидантный эффект, профилактика онкологических заболеваний;
  • снижение жировой массы тела.

Но принимать мелатонин безопасно не для всех. С осторожностью стоит рассматривать терапию мелатонином при наличии эпилепсии, аутоиммунных заболеваний, тяжелой почечной и печеночной недостаточности.

Мои надпочечники устали?

В последние годы наряду с перечисленными выше гормонами в причины старения организма стали записывать так называемый «синдром усталости надпочечников». При этом современная доказательная медицина полностью отрицает существование такого состояния. 

По мнению приверженцев этой теории, постоянный стресс (сопровождаемый выработкой гормонов — особенно кортизола) создает чрезмерную нагрузку на надпочечники — и железы «выгорают». Отсутствие должного количества гормонов надпочечников, якобы возникающее в итоге, приводит к появлению множества симптомов: усталость, проблемы с засыпанием или пробуждением, а также потребность в стимуляторах, таких как кофеин, чтобы сохранять бодрость днем.

В связи с быстрым темпом современной жизни, многие люди находятся в состоянии постоянного стресса и лишены полноценного сна. Легко понять, почему люди находят свои симптомы в «синдроме усталых надпочечников» и с радостью начинают лечить это состояние. Но в систематическом обзоре, опубликованном в 2016 году в BMC Endocrine Disorders, сообщается, что не найдено никакого подтверждения тому, что «усталость надпочечников» действительно существует. Усталость надпочечников не признается Обществом эндокринологов или другими эндокринологическими сообществами, в отличие от реально существующего заболевания — надпочечниковой недостаточности. 

Самое парадоксальное, что «синдром усталости надпочечников» по своим симптомам даже близко не похож на надпочечниковую недостаточность. Первичная надпочечниковая недостаточность может развиваться вследствие аутоиммунного или инфекционного заболевания, метастатического поражения надпочечников, а также из-за их хирургического удаления. Это состояние характеризуется потерей веса, болью в суставах, анорексией, тошнотой, рвотой, диареей, сухостью кожи, низким артериальным давлением и утомляемостью. И, конечно, это заболевание требует гормональной терапии — глюкокортикостероидами, минералокортикостероидами и иногда андрогенами. 

Понравился материал? Подпишитесь на еженедельную email-рассылку Reminder!

как его принимать, куда колоть, дозировка и выбор препарата

Как действует этот гормон. Какой эффект можно ожидать от его применения. Как его правильно ставить, дозировка и комбинация с другими препаратами.

Гормон роста (медицинское название — соматропин) — антагонист инсулина, пептидный гормон, вырабатываемый в передней части гипофиза. Он применяется в силовых видах спорта, при задержке роста, для ускорения процессов восстановления, с целью омоложения организма.

Правильно составленный курс гормона роста открывает пути для решения ряда задач — снижение объема жира, формирование рельефа, увеличение выносливости и силы.

Что принимать?

Одна из главных задач для атлета — подобрать препарат, способный дать ожидаемый эффект без риска для организма. Главный производитель такой продукции — Китай. Чтобы не попасть на подделку, стоит использовать только проверенную продукцию, реализуемую на известных интернет-ресурсах, в аптеке или распространяемую через официальных представителей.

Сегодня наиболее востребованы следующие препараты — Ансомон, Джинтропин, Фероксен, Кигтропин. Практически все варианты на российском рынке имеют китайское происхождение, за исключением нескольких аптечных марок. По качеству они почти не отличаются от европейских аналогов, но зато по цене в 2-3 раза дешевле. В среднем, цена за 5 единиц гормона составляет 10-12 долларов.

Как различить подделку?

Китайцы известны умением создавать препараты-антагонисты инсулина. Так, среди наиболее известных марок стоит выделить Джинтропин и Ансомон. Они имеют лицензию и достойное качество. На флаконах предусмотрен специальный стикер, под которым находится код. Чтобы узнать, оригинален продукт или нет, достаточно ввести данный номер на сайте производителя.

Многие атлеты торопятся с выбором и покупают продукцию низкого качества. В итоге, вместо прироста мышц они получают массу проблем со здоровьем. Чтобы избежать этого, важно внимательно подходить к выбору препарата. Характеристики оригинального гормона роста:

  • Коробка для изделия выполняется из картона, который имеет достаточную плотность и устойчив к влаге.
  • Этикетка наклеена строго горизонтально и идентично на всех флаконах в коробке. Если бумажка с надписями клеится «тяп-ляп», то это один из главных признаков подделки.
  • Вместе с гормоном должен поставляться флакон, наполненный оригинальным растворителем.
  • Верхняя крышка выполнена из алюминия и должна быть ровной.
  • На коробке указан производитель и его сайт. Нелишним будет перейти по предложенному адресу и проверить, существует ресурс на самом деле или нет.
  • Цена. Натуральный антагонист инсулина имеет высокую цену, которая находится в диапазоне 15-25 долларов США за 10 единиц.

Действие ГР при прохождении курса

Перед тем как колоть гормон роста, стоит разобраться с его действием на организм и персональными задачами. Прием добавки обеспечивает следующие эффекты:

  • Мощное анаболическое действие. Наличие в организме достаточного объема соматропина исключает развитие катаболических процессов и уничтожение мышечных клеток. Вот почему ГР рекомендуется ставить утром или в обед.
  • Сжигание жира. Прохождение курса рекомендуется в комплексах, направленных на быстрое похудение при сохранении имеющихся мышц.
  • Увеличение выработки инсулина. Как упоминалось, инсулин и гормон роста — антагонисты. При прохождении курса автоматически активизируется и выработка инсулина. Такой эффект опасен для диабетиков и должен быть учтен.
  • Укрепление костной ткани и активизация ее роста (в случае приема до 26 лет).
  • Ускорение восстановления после активных тренировок. Исследования доказали, что уколы ГР работают на увеличение и восстановление мышц, а также на заживление имеющихся ран.
  • Оптимизация применения энергии.
  • Укрепление иммунной системы.
  • Омолаживающий эффект. Если в России большая часть людей принимает соматропин для улучшения спортивных показателей, то за рубежом для решения другой задачи — омоложения.
  • Стимуляция роста внутренних органов. С возрастом органы человека могут уменьшаться в размерах, атрофироваться. Своевременный прием гормона способствует защите и восстановлению тканей.

Что касается бодибилдинга, то здесь препарат оказывает следующее действие:

  • Обеспечивает сжигание жира и набор мускулатуры. Получается двойной эффект: тело набирает полезную (мышечную) массу и при этом теряет ненужные жировые отложения.
  • Рост объема мышечных клеток. В отличие от простых анаболиков, эффект от которых краткосрочный, по завершении курса гормона роста эффект сохраняется долгое время, а откат минимален.
  • По завершении курса нет необходимости в прохождении послекурсовой терапии.

Побочные эффекты

Перед тем как колоть гормон роста, стоит учесть не только положительные, но и отрицательные качества вещества. Появляются они в случае, когда прием добавки осуществляется в большой дозировке и в течение продолжительного времени.

Наиболее  распространенные побочные эффекты:

  • Появление болей в суставах рук и ног.
  • Увеличение объема жидкости в организме.
  • Рост артериального давления (гипертоникам такими курсами злоупотреблять не стоит).
  • Гипергликемия — рост уровня сахара в крови. Здесь может помочь только инсулин.
  • Гипертрофия сердечной мышцы и прочих органов (возможна при передозировке или длительном приеме).
  • Акромегалия (встречается только в случае злоупотребления препаратом).
  • Увеличение риска развития онкологических заболеваний (в случае предрасположенности).

Если говорить в общем, то побочные эффекты от ГР — редкое явление, если не злоупотреблять продолжительностью курса и не превышать дозировку.

Чтобы снизить риск «побочек» при небольших дозировках (до 10 ед в сутки), достаточно йод-актива и липолиевой кислоты. Если же курс продолжается не больше трех месяцев, то можно отказаться и от них.

Основные варианты курсов

Сегодня стоит выделить несколько вариантов курса гормона роста, каждый из которых имеет свои особенности:

  1. ГР соло. Главная цель — поддержать тонус мышц, наработать рельеф, омолодить организм, улучшить состояние кожных покровов. Главные условия:
    • Начинать прием необходимо с пяти единиц ежедневно. Уколы делаются подкожно.
    • При желании повысить эффект и при отсутствии побочек допускается повышение до 10 единиц. При этом порция принимается не за один раз, а делится на два приема (утром и в обед, но не на ночь). Оптимальное время для укола — на голодный желудок (за 50-60 минут до приема пищи).
    • Длительность — 3-6 месяцев. Если курс будет меньше, то вы можете не ощутить никакого эффекта. Большая продолжительность также нежелательна — повышается риск побочных эффектов. Перерыв следует делать не меньше 4-8 недель.
    • Из-за риска подавления работы щитовидной железы рекомендуется периодически сдавать анализ на ТТГ. В случае угнетения органа рекомендуется прием Т4 (тироксина). Начинать следует с 25 мкг и постепенно повышать дозировку до 100 мкг в сутки, а затем также плавно снижать. При нормальном значении анализа достаточно будет принимать йод-актив.
    • ГР повышает уровень инсулина, поэтому следует следить за уровнем сахара в крови.
    • Учтите, что прием препарата соло крайне низкоэффективен для набора мышечной массы.

    «Чистый» курс может быть дополнен различными добавками. Это вариант для атлетов, которые работают над созданием более рельефной фигуры. Но сколько и чего принимать? Здесь принципы следующие:

    • Для начала вполне достаточно будет хорошего варианта жиросжигателя из спортивного питания — OxyElite, Lipo 6 и т. п.
    • В качестве альтернативы допускается прием эфедрина или кленбутерола. Плюс препаратов — ускорение процесса сжигания жира и выделения мышц. С другой стороны, увеличиваются риски появления побочных эффектов.
    • Для достижения максимального результата в период курса стоит учесть ряд рекомендаций — придерживаться средней калорийности рациона, принимать 2,5-3 грамма белка на кг веса в день и употреблять много жидкости (чем больше, тем лучше). Что касается тренинга — 3-4 силовых занятия в неделю и 3-5 аэробных тренировок. Продолжительность — 60 минут и более.

  2. Гормон роста в комплексе со стероидами. Такой вариант приема хорош для решения двух задач — набора массы и формирования рельефа. Главные особенности заключаются в следующем:
    • Дозировка и схема приема ГР аналогичны первому варианту.
    • Добавляются анаболические стероиды. Если вы работаете на массу, это может быть «длинный» тестостерон, нандролоны, метан, оксиметалон, болденон. На сушке — тестостерон пропионат, тренболон ацетат, мастерон, станозолол. Благодаря сочетанию препаратов удается ускорить рост мышц и добиться сжигания жировых отложений.
    • Период курса составляет, как правило, два-три месяца. Этого достаточно, чтобы гарантировать ожидаемый результат от занятий и исключить последствия для организма. В случае нескольких курсов подряд с перерывом (например, 2 месяца набор, месяц отдых, 2 месяца сушка), гормон роста следует принимать весь этот период.

Некоторые атлеты применяют еще один подход — используют ГР во время «моста» между курсами. Такой вариант гарантирует сохранение мышечной массы в период отдыха от других препаратов.

Как делать инъекции?

Чаще всего гормон роста вводится под кожу. Это значит, что при выполнении таких манипуляций стоит придерживаться техники безопасности и четкого алгоритма:

  1. Вымойте руки с жидким или твердым мылом. Обработайте их спиртом.
  2. Наберите в инсулиновый шприц необходимую порцию состава.
  3. Соберите на животе кожу таким образом, чтобы появилась небольшая складка. Также протрите ее спиртом.
  4. Вводите иголку. Учтите, что острие должно входить в кожу под углом 45 градусов (если смотреть относительно складки).
  5. Вводите весь объем вещества.
  6. Впоследствии старайтесь не делать укол в то же место.

Есть еще один подход — локальные инъекции в мышечные группы (как правило, в те, которые получали нагрузку на последней тренировке). Эта схема применяется в основном спортсменами соревновательного уровня, у которых дневная дозировка препарата превышает 10 единиц.

Колоть состав на ночь (сразу после занятий) запрещено. В противном случае есть риск перебить выброс эндогенного соматропина.

Что влияет на гормон роста?

Каждый спортсмен должен знать, что влияет на соматропин и куда он расходуется. Рассмотрим, что способствует его стимуляции и подавлению.

ГР стимулирует:

  • Соматолиберин — вещество, которое относится к категории антагониста сомастатина. Чем ниже его уровень в организме, тем активнее вырабатывается соматропин.
  • Полноценный сон продолжительностью от 7 часов.
  • Активные физические нагрузки — не меньше трех раз в неделю на протяжении часа.
  • Объем поступающего в организм белка. Чем больше протеина попадает к мышцам, тем лучше.
  • Гипогликемия — проблема, связанная с низким уровнем глюкозы в крови.
  • Пептиды.
  • Активная выработка андрогенов.

К факторам, которые негативно сказываются на гормоне роста, стоит отнести — сомастатин, чрезмерное потребление жирной пищи, эстрогены, инсулин.

Итоги

Пользу и важность данного гормона сложно переоценить. С помощью этого вещества миллионы людей омолаживают организм, добиваются серьезных результатов в спорте, нарабатывают красивое тело и рельеф. Главное — внимательно подходить к выбору препарата, четко соблюдать дозировку и не превышать допустимую продолжительность курса.

Терапия гормоном роста при заболеваниях, сопровождающихся низкорослостью у детей

Авторы: S. Loche, L. Carta, A. Ibba, C. Guzzetti

Статья в формате PDF.

До 1985 года гормон роста (ГР) получали непосредственно из гипофиза животных, поэтому из-за ограниченного количества его использовали только у детей с тяжелым дефицитом ГР. Благодаря технологии рекомбинантной ДНК стало возможным получать неограниченное количество ГР, что позволило не только оптимизировать лечение пациентов с соматотропной недостаточностью, но и оценить эффективность этого препарата при ряде других патологических состояний. В настоящее время применение ГР одобрено для лечения пациентов с синдромом Тернера, хронической почечной недостаточностью, синдромом Прадера-Вилли, синдромом Нунана, дефицитом SHOX, идиопатической низкорослостью, а также детей, рожденных малыми для своего гестационного возраста. В этой статье рассмотрено использование ГР для лечения низкорослости при всех этих состояниях.

Синдром Тернера
Синдром Тернера (СТ) – ​наиболее распространенная хромосомная аномалия у женщин, встречающаяся с частотой приблизительно 1:2000-2500 живорожденных девочек и являющаяся одной из лидирующих причин низкорослости у женщин. СТ обусловлен отсутствием или структурными аномалиями одной из Х-хромосом. Такие пациентки обычно имеют низкий рост, гипергонадотропный гипогонадизм и легкую скелетную дисплазию. Отставание в росте, как правило, начинается пренатально, и уже в первые годы жизни наблюдается прогрессирующее снижение коэффициента стандартного отклонения роста (SDS).
Патогенез низкорослости у девочек с СТ, вероятно, многофакторный, однако недавние исследования показывают, что одной из ведущих причин является гаплонедостаточность гена SHOX (ген низкорослости, содержащий гомеобокс), расположенного в псевдоаутомосомальной области половых хромосом. Было установлено, что изменения костей кисти и запястья одинаковы у девочек с СТ и у пациентов с гаплонедостаточностью SHOX.
Конечный рост у нелеченных пациенток с СТ примерно на 20 см меньше, чем у женщин без этой патологии.
В ряде исследований была показана эффективность ГР в увеличении темпов роста и улучшении конечного результата при низкорослости у девочек с СТ, что стало одним из первых одобренных показаний для применения ГР помимо соматотропной недостаточности. Первое рандомизированное контролируемое исследование, в котором 61 девочку в возрасте 8-12 лет лечили ГР в дозе 0,3 мг/кг/нед в течение в среднем 5,7 года, показало среднее увеличение роста на 7,2 см (D.K. Stephure, 2005). В более недавнем исследовании с участием 27 девочек терапия ГР в дозе 0,1 мг/кг 3 раза в неделю в течение 7,4 года увеличила конечный рост в среднем на 5 см. Стоит отметить, что в обоих исследованиях лечение было начато в середине или конце детского периода, когда отставание в росте было уже очевидной жалобой. Другие исследования показали, что применение ГР, начатое до достижения возраста 4 лет, может обеспечить достижение нормального роста у большинства пациентов (M.L. Davenport et al., 2007; A. Linglart et al., 2011). Хотя данных о долгосрочной эффективности и безопасности лечения ГР у девочек с СТ, начатого в очень раннем возрасте, пока еще недостаточно.
Рекомендуемая доза ГР у девочек с СТ (0,035-0,050 мг/кг/сут) выше, чем при соматотропной недостаточности.
В целом ГР продемонстрировал хороший профиль безопасности у этой категории пациенток, поскольку до сих пор не было зафиксировано случаев серьезных побочных эффектов, связанных с лечением. Тем не менее рекомендуется рутинный мониторинг уровня инсулиноподобного фактора роста‑1 (ИФР‑1) и показателей углеводного обмена.
Для ускорения роста у девочек с СТ также широко используют анаболические стероиды. Два недавних исследования, проведенных в Европе, показали лучший прирост при добавлении оксандролона к ГР по сравнению с монотерапией ГР. Так, в нидерландском исследовании (L.A. Menke et al., 2010) комбинация ГР (0,045 мг/кг/сут) и оксандролона (0,03 мг/кг/сут) привела к среднему увеличению роста на 2,3 см по сравнению с монотерапией ГР, хотя в группе, получавшей оксандролон, была отмечена небольшая задержка в развитии молочных желез. В британском исследовании (E.J. Gault et al., 2011) добавление оксандролона (0,05 мг/кг/сут) к ГР привело к среднему увеличению роста на 4,5 см по сравнению с группой, получавшей только ГР (0,05 мг/кг/нед при ежедневных инъекциях). Побочные эффекты не были зафиксированы в этом исследовании.
Девочки с СТ почти всегда требуют лечения эстрогенами для коррекции недостаточности яичников. До недавних пор обычной практикой была инициация терапии эстрогенами примерно в середине пубертата во избежание уменьшения конечного роста в связи с эстроген-опосредованным закрытием эпифизарных зон роста. Однако данные относительно влияния задержки полового созревания на рост у девочек с СТ пока еще противоречивы. Так, C.A. Quigley и соавт. (2002) показали, что введение малых доз эстрогенов с 8-летнего возраста не оказывает влияния на конечный рост по сравнению с применением только ГР. Другие исследования продемонстрировали, что лечение ГР и эстрогенами, начатое в пубертатном возрасте (около 12 лет), приводит к нормализации конечного роста (C.A. Quigley et al., 2002; Y.K. van Pareren et al., 2003; O. Mehls et al., 2008). Рандомизированное двойное слепое плацебо-контролируемое исследование, проведенное в Великобритании, показало, что лечение эстрогенами, начатое в 14-летнем возрасте, дало среднее увеличение роста на 3,8 см по сравнению с теми девочками, которых начали лечить с 12 лет (E.J. Gault et al., 2011). В то же время недавние данные указывают на то, что терапия ультранизкими дозами эстрогена, начатая уже в 5-летнем возрасте, оказывает благотворное влияние на рост и другие клинические параметры (J.L. Ross et al., 2011). В двойном слепом плацебо-контролируемом испытании в дополнение к ГР у девочек с СТ применяли эстроген в суточной дозе 25 нг/кг в возрасте от 5 до 8 лет и 50 нг/кг в возрасте от 8 до 12 лет. Затем в пубертате все пациентки получали эстрогензаместительную терапию в более высоких дозах. Третья группа девочек получала только плацебо, а четвертая – ​только ГР. Средний рост во взрослом возрасте у пациенток, получавших эстроген и ГР, был на 0,37 SD больше, чем при монотерапии ГР.

Хроническая почечная недостаточность
У большинства пациентов с хронической почечной недостаточностью (ХПН) отмечается снижение темпов роста, которые часто не нормализуются при диализе. За замедление роста у этих больных отвечает комбинация нескольких факторов, среди которых наиболее значимыми считаются алиментарная недостаточность, дисфункция оси ГР/ИФР‑1 и терапия кортикостероидами.
Ряд исследований показал, что лечение ГР повышает скорость роста и улучшает конечный результат у детей с ХПН. Так, D. Haffner и соавт. (2000) наблюдали 38 детей с ХПН (средний возраст на момент включения в исследование – ​10,4±2,2 года, средний рост – ​на 3,1±1,2 SD ниже нормы), которые получали ГР (0,33 мг/кг/нед) в среднем в течение 5,3 года, и 50 детей с ХПН, которым не был назначен ГР. Средний конечный рост у детей в группе терапии ГР составил 165 см для мальчиков и 156 см для девочек, при этом он оказался на 1,6±1,2 SD ниже нормы, но в то же время SDS повысился на 1,4 по сравнению с началом исследования (рСиндром Прадера-Вилли
Синдром Прадера-Вилли (СПВ) – ​редкое генетическое заболевание, которое является результатом отсутствия отцовской копии участка 15-й хромосомы и характеризуется множественными нарушениями, включающими гипотонус, маленькие кисти и стопы, гиперфагию с развитием ожирения, гипогонадизм, низкий рост, общую задержку развития и когнитивные нарушения. Также у этих пациентов часто встречается синдром апноэ во время сна. Распространенность СПВ составляет приблизительно 1:25 000 живорожденных младенцев.
Многие признаки СПВ схожи с симптомами соматотропной недостаточности, в частности замедление роста, снижение мышечного тонуса и изменение конституции тела. Около 80% детей с СПВ имеют дефицит ГР, а также демонстрируют субнормальную реакцию ГР на различные стимулы и снижение спонтанной секреции ГР. У большинства пациентов снижена сывороточная концентрация ИФР‑1.
Контролируемые исследования показали, что у детей с СПВ лечение ГР увеличивает рост, улучшает конституцию тела, повышает мышечную силу и даже оказывает положительное влияние на когнитивные функции (E.P. Siemensma et al., 2012).
Недавно было опубликовано клиническое руководство по терапии ГР у пациентов с СПВ (Growth Hormone Research Society, 2013). Лечение ГР можно начинать с 2 лет (до начала ожирения), хотя некоторые данные предполагают возможность начала терапии в возрасте от 4 до 6 месяцев. Критерии исключения для начала лечения ГР включают: тяжелое ожирение, неконтролируемый диабет, нелеченный тяжелый синдром апноэ во сне, активный рак и психотическое состояние. Сообщалось о нескольких внезапных смертельных исходах у пациентов с СПВ и тяжелым ожирением, получавших ГР.
Лечение ГР у пациентов с СПВ следует начинать с ежедневной дозы 0,5 мг/м2 с последующей корректировкой до рекомендуемой дозы 1,0 мг/м2 (0,035 мг/кг/сут). Уровень ИФР‑1 следует поддерживать в физиологическом диапазоне.

Синдром Нунана
Синдром Нунана (СН) является ауто­сомно-доминантным заболеванием с примерной частотой 1:1000-2500 живорожденных детей. Клинические признаки включают ранние трудности с кормлением, типичные черты лица, пороки сердца (стеноз клапана легочной артерии или гипертрофическая кардиомиопатия), деформации грудной клетки и позвоночника, умеренную умственную отсталость. У 50-70% пациентов с СН отмечается низкорослость: средний рост взрослых лиц с этой патологией колеблется в диапазоне 145-162,5 см для мужчин и 135-151 см для женщин.
СН обусловлен мутациями в генах, которые кодируют белки сигнального пути RAS-MAPK. Около 30-60% случаев вызваны мутациями гена PTPN11, который кодирует тирозинфосфатазу SHP2. Также описаны мутации в генах KRAS, RAF1, SOS1, NRAS и SHOC2. Однако не все пациенты с СН имеют идентифицируемую мутацию. Низкий рост наиболее часто встречается у пациентов с мутациями в гене PTPN11. Это, вероятно, связано с тем фактом, что SHP2 участвует в передаче сигнала ГР-рецептора. В некоторых исследованиях отмечено ухудшение ответа на лечение ГР, а также более низкую сывороточную концентрацию ИФР‑1 у пациентов с мутацией PTPN11, тогда как другие показали увеличение роста после длительного лечения ГР у детей с СН с мутациями PTPN11 и без них.
Применение ГР у пациентов с СН было недавно одобрено Управлением по контролю за качеством пищевых продуктов и лекарств США (FDA). Исследования показывают, что кратковременная терапия ГР у этой категории больных увеличивает скорость роста. Так, по данным J. Dahlgren (2009) увеличение роста при применении ГР у пациентов с СН составляло 0,6-2,0 SD. A.A. Romano и соавт. (2009) опубликовали результаты ретроспективного исследования с участием 65 пациентов с СН, получавших ГР (средняя доза – ​0,047 мг/кг ежедневно) в среднем в течение 5,6 года. Средний прирост по сравнению с прогнозируемым ростом составил 10,9±4,9 см для мужчин и 9,2±4,0 см для женщин.
В представленных исследованиях доза ГР у пациентов с СН варьировала в диапазоне 0,035-0,066 мг/кг/сут, а результат при этом коррелировал с дозой и продолжительностью лечения.
Не сообщалось о побочных эффектах, связанных с лечением. Однако контролируемых исследований по изучению применения ГР у пациентов с СН все еще не хватает.

Недостаточность SHOX
Ген SHOX (short stature homeobox gene) расположен в псевдоаутомосомальной области половых хромосом. Гаплонедостаточность или полная потеря функции SHOX определяют нетипичную пролиферацию и дифференцировку хондроцитов, что вызывает замедленный рост трубчатых костей. Дефицит SHOX отмечен при ряде состояний, включая синдром Лери-Вейля, мезомелическую дисплазию Лангера, СТ, идиопатическую низкорослость.
В двухлетнем рандомизированном исследовании W.F. Blum и соавт. (2007) лечение ГР (0,05 мг/кг/сут) привело к ускорению роста у пациентов с дефицитом SHOX. Более недавнее исследование W.F. Blum и коллег (2013) показало, что 57% пациентов с дефицитом SHOX и 32% больных с СТ, получавших лечение ГР в течение 6-7 лет, достигли роста с отклонением меньше 2SD. Лечение не затрагивало полового созревания в пубертате, а также не сообщалось о других побочных эффектах, связанных с приемом ГР.

Дети, рожденные малыми для гестационного возраста
Дети, родившиеся малыми для гестационного возраста, то есть с дефицитом веса/роста >2 SD, имеют повышенный риск низкорослости во взрослом возрасте. Хотя большинство из них сможет догнать сверстников в первые 2-3 года жизни, около 10% из них все же будут иметь устойчивое отставание в росте.
Был опубликован ряд исследований по лечению ГР у этой категории детей, на основании результатов которых в 2001 году FDA одобрило соответствующее показание для применения ГР (в дозе 0,07 мг/кг/сут у детей, которые родились малыми для гестационного возраста и не смогли наверстать упущенное до 2-летнего возраста). Еще через год такое лечение было одобрено и в Европе (в дозе 0,035 мг/кг/сут с 4 лет).
До настоящего времени опубликовано более 30 исследований по изучению применения ГР у детей, рожденных малыми для гестационного возраста, из которых 4 были контролируемыми. Так, в рандомизированном исследовании Y. van Pareren и соавт. (2003) лечили две группы мальчиков в возрасте до 8 лет ГР в дозе 0,033 или 0,067 мг/кг/сут в течение 7,5-7,9 лет. В результате их рост во взрослом возрасте был на 1,2 и 1,4 SD больше, чем в контрольной группе, соответственно. J.C. Carel и коллеги (2003) лечили 102 пациентов в возрасте в среднем 12,7 лет ГР в дозе 0,067 мг/кг/сут в течение в среднем 2,7 года. Их рост во взрослом возрасте оказался на 1,1 SD больше, чем у лиц из контрольной группы. В исследовании J. Dahlgren и соавт. (2005) 77 пациентов в возрасте в среднем 10,7 года получали ГР в дозе 0,033 мг/кг/сут в течение 5,5-8,8 лет. В итоге средний конечный рост у них был на 0,6 SD больше, чем у нелеченных пациентов. В то же время эти авторы показали, что конечный рост был значительно больше (на 0,4 SD) у пациентов, у которых лечение ГР началось более чем за 2 года до наступления пубертата. M. van Dijk и соавт. (2007) лечили 37 пациентов в возрасте в среднем 8,5 лет ГР в дозе 0,033-0,06 мг/кг/сут в течение в среднем 7,3 года. И снова же, конечный рост у леченных пациентов был на 1,2 SD больше, чем в контрольной группе. A. Maiorana и S. Cianfarani (2009) в своем метаанализе, объединившем 4 контролируемых исследования и 391 пациента, пришли к выводу, что лечение ГР у детей, рожденных малыми для гестационного возраста, приводит к увеличению роста во взрослом возрасте на 0,9 SD по сравнению с контрольной группой без существенных различий между двумя дозами ГР. По данным M.B. Ranke и соавт. (2003), ответ на лечение ГР у данной категории пациентов зависит от дозы, а также от возраста в начале терапии, исходной конституции тела и роста родителей. Показано также, что лечение ГР оказывает положительное влияние на конституцию тела, минеральную плотность костей и мышечную функцию.
До сих пор не было зарегистрировано неблагоприятных эффектов при применении ГР у детей, родившихся малыми для гестационного возраста.
Поскольку есть данные о том, что начало лечения ГР в период пубертата ассоциируется с меньшей эффективностью, A.J. Lem и коллеги (2012) изучили эффективность комбинированной терапии аналогом ГР и аналогом гонадотропин-высвобождающего гормона в рандомизированном исследовании. Они пришли к выводу, что у детей, родившихся малыми для гестационного возраста и имеющих низкий рост в начале пубертата, такое комбинированное лечение может давать преимущества.

Идиопатическая низкорослость
Согласно недавнему консенсусу (Growth Hormone Research Society, Lawson Wilkins Pediatric Endocrine Society и European Society for Paediatric Endocrinology, 2008) идиопатическая низкорослость определяется как состояние, при котором рост индивидуума отстает более чем на 2SD от среднего роста для данного возраста, пола и популяционной группы, без признаков системной, эндокринной, алиментарной и хромосомной патологии. Дети с идиопатической низкорослостью имеют нормальный вес при рождении. В целом этим термином описывают гетерогенную группу детей с отставанием в росте по неизвестным сегодня причинам, включая конституциональную задержку роста и полового созревания, а также семейную форму низкорослости.
В ряде исследований показано, что кратковременный курс лечения ГР (6-12 месяцев) увеличивает скорость роста у подавляющего большинства детей с идиопатической низкорослостью. Ответ на терапию в течение первого года положительно коррелирует с дозой ГР и частотой введения и отрицательно коррелирует со скоростью роста до лечения. На сегодняшний день эффективность ГР у этой категории детей изучена более чем в 20 исследованиях, из которых 3 являются рандомизированными контролируемыми. Так, E.S. McCaughey и соавт. (1998) сообщили о результатах рандомизированного исследования с участием 10 девочек в возрасте 6,2±0,4 года с небольшим ростом, которых лечили ГР в дозе 0,06 мг/кг/сут в течение в среднем 6,2 года. Средний конечный рост у них оказался на 7 см больше, чем в контрольной группе, причем все пациентки в группе лечения достигли своей генетической цели по сравнению с 38% в контрольной группе. E.W. Leshek и соавт. (2004) сообщили, что средний конечный рост у 22 детей с идио­патической низкорослостью (возраст на момент начала лечения – ​12,5±1,6 года), получавших ГР в дозе 0,22 мг/кг/нед (разделенную на три инъекции) в течение в среднем 4,4±1,6 года, был на 0,5 SD больше, чем в контрольной группе. В исследовании K. Albertsson-Wikland и др. (2008) средний конечный рост 49 детей с идиопатической низкорослостью (возраст на момент начала лечения – ​11,5±1,3 года), получавших ГР в дозе 0,033-0,067 мг/кг/нед, был на 0,6 SD больше, чем в контрольной группе.
Во всех исследованиях наблюдалась большая индивидуальная вариабельность ответа на лечение. Был определен ряд факторов, влияющих на конечный результат: возраст начала лечения (чем моложе, тем лучше), рост в начале лечения (чем выше, тем лучше), ответ в течение первого года, доза ГР и средний рост родителей.
Контролируемые исследования по оценке эффективности ГР у детей с идиопатической низкорослостью были недавно проанализированы в метаанализе (A. Deodati, S. Cianfarani, 2011), показавшем увеличение конечного роста на 0,65 SD (около 4 см) по сравнению с контрольной группой.
В целом лечение ГР при идиопатической низкорослости характеризуется благоприятным профилем безопасности, сходным с таковым у пациентов с дефицитом ГР.

Выводы
Лечение ГР показано не только пациентам с соматотропной недостаточностью, но и при ряде других патологических состояний, проявляющихся низкорослостью (синдром Тернера, хроническая почечная недостаточность, синдром Прадера-Вилли, синдром Нунана, дефицит SHOX, идиопатическая низкорослость, рождение с весом и/или ростом, малыми для гестационного возраста). Имеющиеся данные свидетельствуют о том, что лечение ГР полезно при всех этих состояниях, поскольку оно увеличивает конечный рост, а также оказывает положительное влияние на конституцию тела и метаболизм костной ткани.
Поскольку ответ на терапию ГР демонстрирует значительную межиндивидуальную вариабельность, перед принятием решения в каждом отдельном случае следует тщательно рассмотреть клинические, ауксологические и психосоциальные факторы. В целом ответ на терапию ГР заметно коррелирует с возрастом в начале лечения и дозой препарата.
Почти 30-летний опыт использования рекомбинантных препаратов ГР показал, что такое лечение в целом безопасно и не приводит к развитию серьезных нежелательных явлений.

По материалам Loche S., Carta L., Ibba A., Guzzetti C. Growth hormone treatment in non-growth hormone-deficient children. Annals of Pediatric Endocrinology & Metabolism. 2014; 19(1): 1-7.
Список литературы находится в редакции.

Статья напечатана
при поддержке компании Pfizer

Перевод с англ. Натальи Мищенко
WUKGTR0317008

СТАТТІ ЗА ТЕМОЮ Ендокринологія

08.09.2021 Ендокринологія Цукровий діабет та артеріальна гіпертензія

За даними Всесвітньої організації охорони здоров’я, артеріальна гіпертензія (АГ) та цукровий діабет (ЦД) 2 типу є одними з провідних чинників серцево-судинного ризику. За останні 30 років поширеність АГ зменшилася до 1/4 населення світу, але захворюваність на ЦД зросла з 4,7 до 8,5%, і прогноз на майбутнє свідчить про подальший драматичний приріст….

08.09.2021 Ендокринологія Фізіологічна роль та перспективи клінічного застосування R-енантіомера α-ліпоєвої кислоти

Альфа-ліпоєва кислота (АЛК) вперше була виділена в 1951 році як кофермент у циклі Кребса [1]. Це сполучення належить до ліпоамідів, функціонує як кофактор у мультиферментних комплексах, котрі каталізують окислювальне декарбоксилювання α-кислот, як-от піровиноградна й α-кетоглутарова кислоти [2, 3], і є потужним природним антиоксидантом. Згодом було встановлено, що синтетична АЛК існує в R‑ та S-енантіометричних структурних формах у співвідношенні 50:50, при цьому лише R-форма є важливим ендогенним кофактором у біологічних системах [4, 5]….

08.09.2021 Ендокринологія Селенодефіцит і патологія щитоподібної залози: зв’язок, яким не можна нехтувати

Селен – есенціальний мікроелемент, що має надзвичайно важливу роль у забезпеченні фізіологічних процесів людського організму; він необхідний для синтезу низки функціональних білків (селенопротеїнів), через які реалізує антиоксидантні, протизапальні, протипухлинні й інші властивості. Селен був уперше описаний у 1817 р.; свою красиву назву отримав на честь місяця (із грецької – Σελήνη), за однією з версій, завдяки своєму сірому кольору з металевим блиском. Щитоподібна залоза (ЩЗ) – орган з найбільшою концентрацією селену на 1 г тканини, що опосередковано відображає значення цього мікроелемента для нормальної роботи ЩЗ. У цьому огляді підсумовано сучасні знання щодо ролі селену у функціонуванні ЩЗ і ефективності прийому його добавок у лікуванні захворювань ЩЗ….

08.09.2021 Ендокринологія Субклінічний гіпотиреоз і предіабет

Під час чергової сесії науково-освітнього проєкту «Школа ендокринолога», що відбулася 9-12 червня, учасники заходу мали змогу спостерігати за діалогом експертів, присвяченим питанню сполучення і взаємовпливу субклінічного гіпотиреозу та предіабету. В обговоренні взяли участь завідувачка кафедри ендокринології Івано-Франківського національного медичного університету, доктор медичних наук, професор Надія Василівна Скрипник і завідувачка кафедри внутрішньої медицини № 1 Тернопільського національного медичного університету ім. І. Я. Горбачевського, доктор медичних наук, професор Надія Василівна Пасєчко….

Связь между потреблением макро- и микронутриентов и секрецией гормона роста

Резюме

Контекст

Известно, что гормон роста (GH) регулируется с точки зрения питания, но влияние состава рациона на подробные параметры секреции GH ранее всесторонне не оценивалось .

Цель

Целью исследования было определить, связаны ли конкретные макро- и микронутриенты с дискретными параметрами секреции GH среди субъектов с широким диапазоном индекса массы тела.

Дизайн

Подробное потребление макро- и микронутриентов оценивалось с помощью четырехдневных записей о питании, в то время как секреция GH оценивалась стандартным тестированием стимуляции у 108 мужчин и женщин в одном исследовании (исследование 1) и частым забором крови в течение ночи у 12 мужчин. в другом исследовании (Исследование 2).

Результаты

Стимулированный пиком гормона роста был положительно связан с витамином С (r = + 0,29; P = 0,003), пищевыми волокнами (r = + 0,27; P = 0,004), арахидовой кислотой (r = + 0,25; P = 0.008) и поступление бегеновой кислоты (r = + 0,30; P = 0,002) в одномерном анализе. С учетом возраста, пола, расы / этнической принадлежности, висцерального жира, HOMA-IR, общего потребления калорий и этих четырех диетических факторов при пошаговом многомерном моделировании пик GH оставался значимо связанным с витамином C и висцеральным жиром (оба P <0,05). Кроме того, потребление витамина C было связано с различными параметрами эндогенной секреции GH, включая базальную секрецию GH (r = + 0,95; P <0,0001), период полувыведения GH (r = + 0.75; P = 0,005), общее производство GH (r = + 0,76; P = 0,004), площадь GH под кривой (r = + 0,89; P = 0,0001), средний логарифм 10 GH площадь пульса (r = + 0,67; P = 0,02) и ночной максимум (r = + 0,62; P = 0,03), надир (r = + 0,97; P <0,0001) и средняя секреция GH ( r = + 0,89; P = 0,0001).

Выводы

Эти результаты предполагают, что определенные питательные микроэлементы, такие как потребление витамина С, строго и однозначно связаны со стимулированной и эндогенной спонтанной секрецией гормона роста.

Ключевые слова: диета, витамин С, аскорбиновая кислота, частый отбор проб

Введение

Секреция гормона роста (GH) регулируется питанием. Известно, что метаболические стимулы, включая инсулин, глюкозу и свободные жирные кислоты, влияют на секрецию GH и могут действовать через гормон высвобождения гормона роста (GHRH), соматостатин, грелин и другие пути. Эндогенная и стимулированная секреция GH снижается в контексте генерализованного и избыточного висцерального ожирения 1–3 и, как известно, усиливается при голодании 4 .Кроме того, потребление белка, в частности желатина, может резко увеличить секрецию гормона роста в краткосрочной перспективе 5,6 . Однако долгосрочное влияние различных макро- и микронутриентов на секрецию GH до конца не изучено. В то время как Merimee et al. ранее продемонстрировал снижение суммарной секреции GH, оцененное путем получения образцов крови каждый час в течение 24 часов, после высокоуглеводной диеты 7 , это было небольшое исследование с участием только восьми мужчин с нормальным весом, которое не контролировало ковариаты и было ограничено в его оценка секреции GH.Более того, насколько нам известно, влияние потребления микронутриентов на секрецию GH ранее подробно не изучалось.

Одним из представляющих интерес микронутриентов является витамин С. Концентрация витамина С в плазме снижается при ожирении 8, 9 и обратно пропорциональна соотношению талии и бедер, показателю центрального ожирения, независимо от ИМТ 10 . Кроме того, несколько исследований продемонстрировали связь между концентрацией циркулирующего витамина C и риском сердечно-сосудистых заболеваний 11,12 , параллельную ассоциации снижения секреции GH с абдоминальным ожирением и повышенным риском сердечно-сосудистых заболеваний 3,13,14 .Кроме того, Tran CD et al. ранее продемонстрировали положительную взаимосвязь между потреблением витамина С с пищей и концентрацией IGF-1 15 , что указывает на возможную взаимосвязь между потреблением витамина C и секрецией GH.

Таким образом, мы исследовали роль состава рациона, включая потребление витамина C, на секрецию GH путем анализа записей о четырехдневном питании и добавках субъектов из двух ранее завершенных клинических исследований, в которых изучались подробные параметры стимулированной и эндогенной спонтанной секреции GH. .Мы предположили, что потребление определенных макро- и микронутриентов будет связано с дискретными параметрами как стимулированной, так и эндогенной спонтанной секреции GH.

Методы и процедуры

Субъекты исследования

Исследование 1

Были изучены сто восемь здоровых мужчин и женщин из района Бостона. Данные подгруппы этих субъектов были ранее опубликованы в исследовании, оценивающем взаимосвязь между секрецией GH и сердечно-сосудистыми индексами 14 , однако подробное потребление макро- и микронутриентов этими субъектами не сообщалось.Это были взрослые в возрасте от 18 до 55 лет с широким диапазоном ИМТ. У субъектов не было выявленных заболеваний гипофиза. Критерии исключения включали наличие в анамнезе сахарного диабета, заболеваний щитовидной железы, хронических заболеваний, таких как ВИЧ-инфекция, или любых медицинских состояний, которые, как известно, влияют на ось GH. Исключались субъекты, принимавшие лекарства, которые, как известно, влияют на секрецию гормона роста. Исключались также пациенты с креатинином сыворотки> 1,5 мг / дл, гемоглобином <11 г / дл или аспартатаминотрансферазой> 2,5 раза превышающими верхний предел нормального диапазона.

Исследование 2

Были обследованы двенадцать в целом здоровых мужчин из Бостона. Данные этих субъектов были ранее опубликованы в исследовании, оценивающем эффект краткосрочной стратегии увеличения эндогенной пульсации GH с использованием гормона высвобождения гормона роста 16 . Подробное потребление микронутриентов этими субъектами еще не сообщалось, и теперь мы сравниваем потребление макро- и микронутриентов с параметрами эндогенной секреции GH, полученными на исходном уровне, до любого вмешательства в исследование.Это были взрослые мужчины в возрасте от 18 до 60 лет с ИМТ от 20 до 35 кг / м 2 2 . Субъекты не имели известных заболеваний гипофиза, в анамнезе не имели краниальной радиации или тяжелых заболеваний почек, печени или хронических заболеваний. Дополнительные критерии исключения включали использование кортикостероидов, гонадных стероидов или антидиабетических средств.

Все субъекты прошли письменное информированное согласие в соответствии с руководящими принципами Подкомитета по исследованиям на людях в Массачусетской больнице общего профиля до проведения каких-либо процедур исследования.

Оценка секреции GH

Все субъекты в исследовании 1 прошли стандартное тестирование стимуляции GH с GHRH и аргинином, как сообщалось ранее 3,14 . Вкратце, после ночного голодания субъектам внутривенно вводили GHRH 1-29 [1 мкг / кг] (Sermorelin ацетат, Geref, Serono Laboratories, Inc., Norwell, MA) с последующим введением гидрохлорида аргинина [30 г / 300 мл (макс. грамм)]. Уровни GH измерялись на 0, 30, 45, 60, 90 и 120 минутах. Все субъекты в исследовании 2 подвергались частому забору крови на GH в течение ночи с частотой каждые 10 минут с 20:00 до 07:40 часов, за исключением одного субъекта, который часто брал образцы крови каждые 20 минут.Параметры, описывающие эндогенную секрецию GH, включая базальную секрецию, физиологический период полувыведения, частоту пульса и площадь пульса, определяли с помощью программы автоматического анализа деконволюции Auto-Decon 17 . Для двух профилей GH, в которых отсутствовали три последовательных образца, последнее значение GH было перенесено на 1, чтобы можно было провести анализ.

Лабораторные методы

Сывороточный GH был определен с помощью сверхчувствительного анализа человеческого GH Beckman Access, хемилюминесцентного иммуноанализа с парамагнитными частицами (Beckman Coulter, Chasta, MN) с эффективной аналитической чувствительностью 0.01 мкг / литр. CV внутри анализа составляет 1,90–2,78%, а CV между анализами составляет 1,77–2,65%. Уровень глюкозы натощак определялся по стандартной методике в нашей клинической лаборатории. Инсулин измеряли с помощью парамагнитной частицы, хемилюминесцентной иммуноаналитической системы Access (Beckman Coulter, Chasta, MN), с аналитической чувствительностью 0,03 МЕ / мл и точностью 3–5,6%. Уровень IGF-1 в сыворотке измеряли с помощью EIA (Alpco Diagnostics, Inc., Салем, штат Нью-Хэмпшир) с пределом обнаружения 2,3 мкг / л, CV внутри анализа 6.От 6 до 9,7% и CV между анализами от 11,3 до 13,7% и доступно для 85 субъектов.

Антропометрические измерения

Рост и масса тела были получены после ночного голодания. Общий процент жира в организме определяли методом двойной рентгеновской абсорбциометрии (DXA) с использованием денситометра Hologic-4500 (Hologic, Inc., Waltham, MA). Кроме того, КТ брюшной полости в поперечном сечении 1 см выполнялась на уровне L4 для оценки распределения подкожной жировой ткани брюшной полости (SAT) и висцеральной жировой ткани брюшной полости (VAT), как описано ранее 18 .

Оценка потребления питательных веществ

Абсолютное потребление (в граммах / день) макро- и микронутриентов, включая определенные углеводы, аминокислоты, жирные кислоты и витамины, было определено с использованием 4-дневных записей о питании, проведенных квалифицированным дипломированным диетологом во время прямое интервью. Данные были проанализированы с использованием программного обеспечения Nutrition Data Systems for Research (NDSR) с данными NDSR 2008 (версия 2, Университет Миннесоты, Миннеаполис, Миннесота). Записи о питании были доступны для всех 108 субъектов в исследовании 1 и всех 12 субъектов в исследовании 2.

Статистический анализ

В исследовании 1 пик стимулированного GH был связан с демографическими и антропометрическими параметрами, включая возраст и ИМТ, а также потребление различных макро- и микронутриентов с использованием одномерного регрессионного анализа с корреляциями Пирсона. Также был проведен одномерный регрессионный анализ для оценки взаимосвязи между IGF-1 и различными макро- и микронутриентами. Индексы питательных веществ, которые показали значительную связь с пиковым стимулированным GH при одномерном анализе, были дополнительно исследованы с использованием многомерных регрессионных моделей для оценки взаимосвязи между отдельными питательными веществами и пиковым стимулированным GH GH, с поправкой на влияние потенциальных ковариат, роль которых в регуляции секреции GH имеет ранее было установлено.Ковариаты, которые контролировались в каждой модели, включали возраст, пол, расу, этническую принадлежность, антропометрические измерения, HOMA-IR и общее потребление калорий. Хотя ранее не было продемонстрировано, что общее потребление калорий связано с секрецией GH, оно было включено во все модели многомерной регрессии, чтобы отличить эффекты отдельных питательных веществ от общего потребления калорий. Моделирование регрессии методом наименьших квадратов было выполнено с использованием ИМТ и повторено с использованием висцерального жира в качестве репрезентативных антропометрических измерений.В окончательной модели был проведен поэтапный регрессионный анализ, включая все индивидуальные индексы питательных веществ, которые, как было показано, независимо связаны с пиковым стимулированным GH в предыдущих многомерных моделях (клетчатка, витамин C, бегеновая кислота и арахидовая кислота), чтобы избежать любого потенциального взаимного влияния. -зависимость между диетическими индексами и определение того, какие индексы наиболее сильно связаны с пиковой стимуляцией гормона роста. В исследовании 2 одномерный регрессионный анализ Пирсона использовался для связи параметров эндогенной спонтанной секреции GH, включая базальную секрецию, физиологический период полураспада, количество событий пульсирующей секреции, общую продукцию, процент пульсирующей секреции, площадь под кривой, средний логарифм. 10 Площадь пульса, ночной максимум, надир и среднее значение GH для переменных питательных веществ, которые, как было обнаружено, в значительной степени связаны с пиковым стимулированным GH в исследовании 1.Анализы чувствительности были выполнены за исключением 4 субъектов с потреблением витамина C> 1000 мг / день в исследовании 1. Анализы чувствительности не проводились в исследовании 2, так как все субъекты получали витамин C <1000 мг / день. Статистический анализ выполнялся с использованием JMP 9.0.0 (Институт SAS, Кэри, Северная Каролина, США). Статистическая значимость была определена как P <0,05.

Результаты

Клинические характеристики и значения потребления питательных веществ участниками исследования 1

Возраст участников исследования 1 варьировался от 18 до 55 лет со средним возрастом 43 года (диапазон IQ: 33–48.75 лет). Испытуемые составляли 53,7% мужчин и 58,3% европеоидов. ИМТ испытуемых варьировался от 19,3 до 62,8 кг / м 2 при медиане 32,7 кг / м 2 (диапазон IQ: 23,6–38,9 кг / м 2 ). Антропометрические, метаболические и пищевые показатели потребления испытуемых в исследовании 1 представлены в. В настоящее время рекомендованная в США суточная доза витамина С составляет 75 мг / день для женщин и 90 мг / день для мужчин в возрасте от 19 до 60 лет 19 . В нашей выборке 48 субъектов (44%) не соответствовали рекомендуемой RDA США.

Таблица 1

Характеристики и значения потребления питательных веществ в исследовании 1 (n = 108). Значения представлены как медианы (диапазон IQ).

Талия Талия окружность (см) 28,3)
Все субъекты

N 108
Возраст (лет) 43 (3316–48157) мужчин (%) 58 (53,7%)
Раса, n (%)
Кавказский 63 (58.3%)
Не европеоид 45 (41,7%)
Состав тела
ИМТ (кг / м 2 ) 32,7 (23,6–38,9)
106,2 (84,7–121,7)
SAT by Abd CT (см 2 ) 332 (166–539)
VAT by Abd CT (см 2 ) 117 (57–207)
% всего жира по DEXA 31.0 (23,7–39,9)
Потребление питательных веществ
Калории (ккал) 2053 (1610–2563)
Углеводы (г) 259 (182–309) Белок (г) 87 (72–113)
Жир (г) 79 (58–107)
Холестерин (мг) 261 (179–411)
Насыщенные жиры Кислоты (г) 25 (17–34)
Трансжирные кислоты (г) 3.9 (2,4–5,8)
Клетчатка (г) 16 (12–22)
Витамин C (мг) 94 (52–156)
SFA 20: 0 (арахидовая кислота ) (г) 0,1 (0,07–0,15)
SFA 22: 0 (бегеновая кислота) (г) 0,05 (0,03–0,11)
TRANS 18: 1 (элаидиновая кислота) (г) 3,3 (1,9–4,8)
TRANS 18: 2 (транс-линолелаидовая кислота) (г) 0,5 (0.3–0,7)
Параметры гормона роста
ГР натощак (мкг / л) 0,12 (0,03–0,31)
Пик-стимулированный ГР (мкг / л) 10,67 (5,2168)
IGF-1 (мкг / л) 79,1 (64,5–101,3)

Одномерные ассоциации с пиковым стимулированным GH в исследовании 1

Пик стимулированного GH отрицательно ассоциировался с возрастом (r = — 0,28; P = 0,004), ИМТ (r = -0.62; P <0,0001), окружность талии (r = -0,72; P <0,0001), SAT (r = -0,53; P <0,0001), НДС (r = -0,66; P <0,0001) и процент жира в организме (r = -0,41; P <0,0001), а также глюкоза натощак (r = -0,27; P = 0,005), инсулин натощак (r = -0,44; P <0,0001) и HOMA- ИК (r = -0,37; P = 0,0002).

Стимулированный пиком гормона роста был положительно связан с витамином С (r = + 0,29; P = 0,003), пищевыми волокнами (r = + 0.27; P = 0,004), потребление арахиновой кислоты (r = + 0,25; P = 0,008) и бегеновой кислоты (r = + 0,30; P = 0,002) в одномерном анализе (). Стимулированный пиком GH был отрицательно связан с пищевым холестерином (r = -0,26; P = 0,006), общим количеством трансжирных кислот (r = -0,24; P = 0,01), элаидиновой кислотой (r = -0,24; P ). = 0,01) и транс-линолелаидовой кислоты (r = -0,24; P = 0,01) в однофакторном анализе ().

Таблица 2

Одномерный анализ переменных пикового стимулированного ГР и потребления питательных веществ для всех участников исследования 1

калорий.03 9016 (элаидиновая кислота)
Переменное потребление питательных веществ R P
0,76
Углеводы −0,002 0,99
Белок −0,07 0,45
Жир 0,006
Транс-жирные кислоты -0,24 0,01
Волокно +0,27 0,004
Витамин C +0.29 0,003
SFA 20: 0 (арахидовая кислота) +0,25 0,008
SFA 22: 0 (бегеновая кислота) +0,30 0,002 -0,24 0,01
TRANS 18: 2 (транс-линолелаидовая кислота) -0,24 0,01

Витамин D, E и омега-3 жирные кислоты не были связаны с жирными кислотами пик стимулировал GH.Все другие определенные углеводы, аминокислоты и жирные кислоты, которые были исследованы, не были существенно связаны с пиковым стимулированным GH.

Одномерные ассоциации с IGF-1 в исследовании 1

IGF-1 был отрицательно связан с возрастом (r = -0,41; P = 0,0001) и ИМТ (r = -0,26; P = 0,02). IGF-1 был положительно связан с потреблением пищевых волокон (r = + 0,24; P = 0,03), но не был связан с потреблением макроэлементов или витамина C, бегеновой или арахидовой кислоты (все P> 0,05).

Витамин С и показатели центрального ожирения в исследовании 1

Потребление витамина С с пищей было обратно связано с НДС, измеренным с помощью КТ поперечного сечения (r = -0.20; P = 0,04) и имеет тенденцию к обратной связи с окружностью талии (r = -0,03; P = 0,08) и соотношением талии к бедрам (r = -0,18; P = 0,08).

Многомерный анализ пикового стимулированного GH в исследовании 1

Отдельные многомерные регрессионные модели, оценивающие взаимосвязь между отдельными диетическими индексами, которые были в значительной степени связаны с пиковым стимулированным GH в одномерном анализе, с учетом возраста, пола, расы, этнической принадлежности, НДС, HOMA- IR и общее потребление калорий.В этих моделях пик GH оставался значимо связанным с витамином C (β = 0,03, P = 0,007, R 2 для модели = 0,50, P для модели <0,0001) (), клетчатка (β = 0,62, P = 0,009, R 2 для модели = 0,50, P для модели <0,0001) (), арахиновая кислота (β = 43,79, P = 0,05, R 2 для модели = 0,48, P для модели <0,0001) () и бегеновой кислоты (β = 33,92, P = 0,04, R 2 для модели = 0,48, P для модели <0.0001) () прием. При контроле ИМТ вместо НДС в многомерных моделях витамин C (β = 0,02, P = 0,03, R 2 для модели = 0,62, P для модели <0,0001) и бегеновая кислота (β = 31,01). , P = 0,03, R 2 для модели = 0,62, P для модели <0,0001) остались значимыми, в то время как волокно (β = 0,40, P = 0,06, 2 рэндов для модели = 0,61, P для модели <0,0001) и арахиновой кислоты (β = 34,95, P = 0,07, R 2 для модели = 0.61, P для модели <0,0001) имеют тенденцию к статистической значимости. Потребление диетического холестерина, общего количества трансжирных кислот, элаидиновой кислоты и транс-линолелаидовой кислоты (все P > 0,1) больше не было значимо связано с пиковым стимулированным GH после контроля этих ковариат.

Таблица 3

<0,000 1,40 007
A. Многомерное моделирование пикового стимулированного GH с учетом возраста, пола, расы, этнической принадлежности, НДС, HOMA-IR, общего потребления калорий и потребления витамина C.R 2 для общей модели = 0,50 и значение P для общей модели <0,0001.

B оценка Стандартная ошибка P
Возраст -0,31 0,21 или нет) 0,79 2,24 0,73
Раса (европеоидная или нет) −0,45 1.98 0,82
Этническая принадлежность (латиноамериканец или нет) −2,55 3,13 0,42
НДС −0,13 0,02 1,05 0,19
Общая калорийность −0,0009 0,003 0,72
Потребление витамина С 0,03 0,01
902 2,0 Этническая принадлежность (латиноамериканец или нет) 09 9015 9015 9015 9015 9016 мужчина 9016 ) .80
B. Многомерное моделирование пикового стимулированного GH с учетом возраста, пола, расы, этнической принадлежности, НДС, HOMA-IR, общего потребления калорий и потребления клетчатки. R 2 для общей модели = 0,50 и значение P для общей модели <0,0001.

Оценка B Стандартная ошибка P
Возраст -0,33 0.21 0,12
Пол (мужской или нет) 1,69 2,30 0,47
Раса (европеоид или нет) -1,62 1,96 0,46 1,96 0,46 или нет) −4,00 3,16 0,21
НДС −0,12 0,03 <0,0001
HOMA-IR −1,56 −1,56 −1,5615
Общее потребление калорий −0,005 0,003 0,15
Потребление клетчатки 0,62 0,23 0,009
для возраста, пола, расы, этнической принадлежности, НДС, HOMA-IR, общей калорийности и потребления арахиновой кислоты. R 2 для общей модели = 0,48 и значение P для общей модели <0,0001.

Оценка B Стандартная ошибка P
Возраст −0.24 0,21 0,17
Пол (мужской или нет) 0,25 2,29 0,91
Раса (европеоид или нет) -1,85 −3,25 3,20 0,31
НДС −0,13 0,03 <0,0001
HOMA167 − 0,22
Общее потребление калорий −0,002 0,003 0,46
SFA 20: 0 (арахидовая кислота) 43,8 21902
D. Многовариантное моделирование для пикового стимулированного GH с учетом возраста, пола, расы, этнической принадлежности, НДС, HOMA-IR, общего потребления калорий и потребления бегеновой кислоты. R 2 для общей модели = 0,48 и значение P для общей модели <0.0001.

Оценка B Стандартная ошибка P
Возраст -0,21 0,21 0,21 −0,03 2,29 0,99
Раса (европеоидная или нет) −2,16 2,03 0,29
Этническая принадлежность (латиноамериканец или нет) 3,21 0,39
НДС −0,13 0,03 <0,0001
HOMA − IR −1,40 1,08 9016 902 902 0,0001 0,003 0,96
SFA 22: 0 (бегеновая кислота) 33,92 16,65 0,045

Комбинированная прямая ступенчатая многомерная модель GH, включающая в себя четырехмерную стимулированную модель GH, была для Было показано, что отдельные питательные вещества независимо связаны с пиковым стимулированным GH в вышеупомянутых многомерных моделях (витамин C, клетчатка, бегеновая кислота и арахидовая кислота), чтобы определить, какое питательное вещество наиболее сильно связано с пиковым стимулированием GH.Независимые переменные возраста, пола, расы / этнической принадлежности, НДС, HOMA-IR, общего потребления калорий и потребления витамина С, клетчатки, бегеновой и арахиновой кислоты одновременно проверялись на предмет включения в модель. Из независимых переменных только НДС и витамин C были выбраны для включения в моделирование в качестве значимых параметров, независимо связанных с пиковым стимулированным GH ( P <0,05). В этой комбинированной модели только витамин С, но не клетчатка, бегеновая или арахидовая кислота, были в значительной степени связаны с пиковым стимулированным GH.

Анализы чувствительности, за исключением субъектов с потреблением витамина C> 1000 мг / день в исследовании 1

Четыре из 108 субъектов получали витамин C> 1000 мг / день. Анализ чувствительности, исключающий этих четырех субъектов, существенно не повлиял на результаты. Потребление витамина C оставалось значимо связанным с пиковым стимулированным GH (r = + 0,29; P = 0,01) среди оставшихся 104 субъектов.

Клинические характеристики и значения потребления питательных веществ у субъектов исследования 2

Возраст участников варьировался от 21 до 58 лет со средним возрастом 49 лет (диапазон IQ: 35.75–55 лет). Все испытуемые были мужчинами, 83,3% составляли европеоид. ИМТ варьировал от 20,9 до 33,6 кг / м 2 со средним ИМТ 27,6 кг / м 2 (диапазон IQ: 24,3–32,1 кг / м 2 ). Подробная информация об их питании представлена ​​в. Три субъекта (25%) не соответствовали рекомендуемой в США RDA по потреблению витамина C в исследовании 2.

Таблица 4.

Значения потребления питательных веществ субъектами в исследовании 2 (n = 12). Значения представлены как медианы (диапазон IQ).

Все испытуемые (n = 12)

Общая энергия (ккал) 2647 (2569–3005)
34 Углеводы 292–392)
Белок (г) 116 (83–135)
Жир (г) 99 (67–112)
Холестерин (мг) 309 (146) 468)
Насыщенные жирные кислоты (г) 29 (17–41)
Трансжирные кислоты (г) 3.6 (2,5–6,1)
Клетчатка (г) 22 (18–42)
Витамин C (мг) 133 (78–254)
SFA 20: 0 (арахидовая кислота ) (г) 0,14 (0,08–0,19)
SFA 22: 0 (бегеновая кислота) (г) 0,06 (0,04–0,22)
TRANS 18: 1 (элаидиновая кислота) (г) 2,9 (2,1–5,0)
TRANS 18: 2 (транс-линолелаидовая кислота) (г) 0,5 (0,4–0,8)

Связь потребления питательных веществ с параметрами эндогенной спонтанной секреции GH в исследовании 2

Четыре индекса питательных веществ, витамин С, потребление клетчатки, арахиновой кислоты и бегеновой кислоты, которые были определены как независимо связанные с пиком стимулированного гормона роста при стандартном тестировании стимуляции в исследовании 1, были оценены на предмет их связи с параметрами эндогенного гормона роста. секреция.Потребление витамина C было связано с базальной секрецией GH (r = +0,95; P <0,0001), периодом полураспада GH (r = + 0,75; P = 0,005), общим образованием GH (r = + 0,76; P = 0,004), площадь GH под кривой (r = + 0,89; P = 0,0001), средний логарифм 10 Площадь пульса GH (r = + 0,67; P = 0,02) и ночной GH максимум (r = + 0,62; P = 0,03), надир (r = + 0,97; P <0,0001) и среднее значение (r = + 0,89; P = 0,0001) в одномерном анализе (). Потребление клетчатки было связано с базальной секрецией GH (r = + 0.76; P = 0,004), средний логарифм 10 Площадь пульса GH (r = + 0,67; P = 0,02) и ночной надир GH (r = + 0,60; P = 0,04) в одномерном анализе. Потребление арахиновой кислоты отрицательно связано с физиологическим периодом полужизни GH (r = -0,59; P = 0,04), но никакими другими параметрами эндогенной секреции GH. Потребление бегеновой кислоты отрицательно связано с максимальной секрецией GH в течение ночи (r = -0,61; P <0,05) и имеет тенденцию к значимости с физиологическим периодом полувыведения (r = -0.56; P = 0,06) и средний логарифм 10 GH площадь пульса (r = -0,54; P = 0,07).

Таблица 5

Одномерный анализ потребления витамина С по параметрам эндогенной спонтанной секреции GH среди всех участников исследования 2 (n = 12).

75 Ночь62 9-
r P

Базальная секреция гормона роста +0,95 <0,00016 GH полураспада-
0,005
Количество импульсов секреции гормона роста в ночное время −0,30 0,35
Общее производство гормона роста +0,76 0,004
GH в процентах
Площадь под кривой GH +0,89 0,0001
Среднее значение 10 Площадь импульса GH +0,67 0,02
максимум 0,03
Надир GH на ночь +0,97 <0,0001
Среднее значение GH на ночь +0,89 0,0001
Обсуждение первой ассоциации 9-000 и переменные потребления питательных микроэлементов и дискретные измерения секреции GH у здоровых в остальном мужчин и женщин. Наши данные демонстрируют значительную связь между витамином C и пиковым стимулированным GH при стандартном клиническом тестировании стимуляции и различными репрезентативными параметрами эндогенной спонтанной секреции GH.Результаты показывают, что снижение потребления витамина С может быть независимо связано со снижением секреции гормона роста.

Предыдущие исследования по оценке различных регуляторов секреции GH были сосредоточены на различных физиологических гормонах, включая инсулин, глюкозу, свободные жирные кислоты и нейропептиды, такие как GHRH, соматостатин и различные факторы высвобождения GH. Хотя van Vught et al. провели подробные исследования, оценивающие влияние потребления белка на острую стимуляцию гормона роста. 5, 6 ; ограниченные исследования оценили роль потребления макроэлементов в долгосрочной регуляции гормона роста.Более раннее исследование с участием 35 пожилых людей не смогло обнаружить никакой связи между потреблением макронутриентов и утренним гормоном роста. Однако в этом исследовании GH оценивался через 2–3 часа голодания и измерялся между 08:00 — 12:00 (полдень), и ни стандартные клинические тесты стимуляции, ни частый забор проб в ночное время не проводились. 20 . В то время как одно интервенционное исследование продемонстрировало подавление суммарной секреции гормона роста после изокалорийной высокоуглеводной диеты 7 , одна неделя низкоуглеводной высокобелковой диеты не повлияла на 24-часовую концентрацию гормона роста, измеряемую каждые 20 минут 21 .Точно так же две недели диеты с высоким содержанием жиров или углеводов не повлияли на голодание GH 22 . Однако эти исследования, изучающие взаимосвязь между потреблением макронутриентов и гормоном роста, ограничены их небольшим размером, короткой продолжительностью вмешательства и методом оценки гормона роста.

Микроэлементы, в частности ретиноевая кислота или витамин А, в предыдущих исследованиях показали, что они играют роль в секреции гормона роста. Исследования in vitro продемонстрировали стимуляцию секреции гормона роста в клетках гипофиза человека и крысы витамином А 23, 24 , а одно клиническое исследование продемонстрировало положительную корреляцию между уровнями витамина А в плазме и ночной секрецией гормона роста у детей с нарушением ночного гормона роста. секреция 25 .Теперь мы демонстрируем потенциальную новую роль потребления витамина С с пищей в регулировании секреции GH в двух независимых клинических исследованиях. В нашем первом исследовании мы демонстрируем значительную положительную связь между потреблением витамина C и пиком стимулированной секреции GH при стандартном тестировании на стимуляцию у 108 здоровых в остальном мужчин и женщин, которая остается значимой при контроле общего потребления калорий и переменных, роль которых в секреции GH ранее оценивалась. опубликовано (возраст, пол, раса / этническая принадлежность, висцеральное ожирение и инсулинорезистентность).Ранее продемонстрированная отрицательная связь между GH и возрастом и висцеральным ожирением была подтверждена в нашем исследовании. Поэтому мы контролировали эти возможные ковариаты в многомерном моделировании и обнаружили, что положительная связь между витамином C и GH остается значительной. Кроме того, положительная связь между потреблением витамина C и секрецией GH подтверждается нашим вторым исследованием, в котором эндогенная спонтанная секреция GH изучалась путем частого отбора проб каждые 10 минут в течение ночи.Наша демонстрация положительной связи между потреблением витамина C и секрецией GH согласуется с данными предыдущего исследования о положительной связи между потреблением витамина C с пищей и концентрацией IGF-1 и может помочь объяснить результаты предыдущего исследования. Хотя в нашем исследовании мы не наблюдали прямой зависимости между потреблением витамина С с пищей и концентрацией IGF-1, это может быть связано с меньшим размером выборки в нашем исследовании (108 субъектов по сравнению с 1542 субъектами в исследовании Tran et al. 15 ).

Это исследование не было разработано для оценки механизма того, как потребление витамина C с пищей влияет на секрецию GH, а скорее как исследование, генерирующее гипотезу, для определения макро- и микронутриентов, которые могут иметь физиологическую роль в регуляции GH. Тем не менее, предыдущие исследования предполагают, что между потреблением витамина C и секрецией GH может существовать физиологическая связь. Витамин C хорошо известен как антиоксидант, но он также действует как кофактор для пептидилглицин-α-амидирующей монооксигеназы (PAM), которая отвечает за амидирование различных нейропептидов 26 .Тканевая экспрессия PAM изучалась на животных моделях, и очень высокие тканевые концентрации активности PAM были продемонстрированы как в гипоталамусе, так и в гипофизе 27,28 . Кроме того, было показано, что активность PAM в сыворотке крови и гомогенатах тканей крыс, а также в культивируемых клетках передней доли гипофиза крыс чувствительна к лечению витамином C 27,29 . Кроме того, витамин С активно транспортируется через мембраны с помощью ко-транспортера аскорбата натрия (SVCT) 1 и 2 30 .SVCT2, в частности, экспрессируется в нейронах и эндокринных клетках 31 , а также в таницитах гипоталамуса 32 , что обеспечивает высокие концентрации местного витамина C по сравнению с циркулирующим витамином C. Секреция GH, рилизинг-гормон GH (GHRH), как известно, представляет собой C-концевой амидированный пептид 33–35 , что позволяет предположить возможную роль микронутриента витамина C в регуляции секреции GH посредством посттрансляционного процессинга GHRH.Таким образом, SVCT2 может допускать более высокую локальную концентрацию витамина С в гипоталамусе, что приводит к увеличению активности PAM, что приводит к большей эффективности амидирования и активации GHRH, тем самым увеличивая передачу сигналов GH. Хотя это предположение, эти предыдущие исследования в сочетании с настоящим исследованием предполагают, что необходимы дальнейшие исследования взаимосвязи между витамином C и GH.

Сильными сторонами нашего исследования являются изучение подробных показателей стимулированной и эндогенной спонтанной секреции GH, использование относительно большой популяции 108 мужчин и женщин с ожирением и без ожирения в исследовании 1, а также его проверка в отдельном более подробном исследовании. физиологическое исследование, которое подтверждает ассоциации с использованием другого метода оценки секреции GH.Ограничения включают в себя схему наблюдения, нашу неспособность учитывать пищевые добавки, которые могут иметь энергетический или питательный эффект на секрецию гормона роста, а также использование самостоятельных записей о пищевых продуктах. Кроме того, мы не смогли измерить конкретные уровни питательных микроэлементов в кровообращении, связанные с параметрами GH. Хотя инструменты для самостоятельной оценки потребления пищи широко используются, они могут быть связаны с некоторой неточностью. 36–40 . В частности, субъекты склонны занижать общее потребление калорий и белка; однако Bingham et al .продемонстрировали значительную корреляцию (ранговая корреляция Спирмена 0,86) между уровнем витамина С в плазме, измеренным с помощью жидкостной хроматографии с электрохимическим обнаружением, и зарегистрированным потреблением витамина С с пищей, что позволяет предположить, что на этот микронутриент может в меньшей степени влиять общее занижение данных, наблюдаемое в отзыве о питании 36 . Таким образом, мы смогли выявить значительную взаимосвязь между секрецией GH и потреблением витамина C в двух независимых исследованиях. В этом исследовании потребление витамина С было в значительной степени связано с НДС, показателем центрального ожирения.Учитывая известную связь между GH и показателями центрального ожирения 3 , эта связь может быть полностью опосредована НДС. Однако при многомерном регрессионном моделировании мы контролировали НДС, и связь между потреблением витамина C с пищей и пиковым стимулированным GH оставалась значительной, что делает это маловероятным. Также возможно, что взаимосвязь, которую мы демонстрируем между секрецией GH и потреблением витамина C, является показателем здорового образа жизни, такого как потребление большого количества фруктов и овощей, потому что мы не смогли контролировать эту переменную в настоящем исследовании.Это исследование представляет собой предварительное ретроспективное исследование. Таким образом, будущие исследования, регулирующие потребление витамина С с пищей, будут полезны для оценки их истинного вклада в секрецию GH. Будущие исследования, использующие процентное соотношение рекомендуемого суточного потребления для значений потребления питательных веществ, чтобы учесть изменение потребностей в питательных веществах в зависимости от возраста и физической активности, также могут быть полезными.

Таким образом, мы впервые демонстрируем, что потребление витамина C в значительной степени связано с дискретными параметрами стимулированной и эндогенной спонтанной секреции GH.Кроме того, эта взаимосвязь кажется независимой от потенциальных ковариат, таких как возраст, пол, НДС, HOMA-IR, общее потребление калорий и потребление других микроэлементов. Связь между GH и витамином C, выявленная в этом исследовании, предполагает потенциальную полезность интервенционного исследования, чтобы определить, может ли увеличение потребления витамина C повлиять на эндогенную секрецию GH.

Гормон роста — канал лучшего здоровья

Гипофиз — это структура в нашем мозгу, которая вырабатывает различные типы специализированных гормонов, включая гормон роста (также называемый гормоном роста человека или HGH).Роль гормона роста включает в себя влияние на наш рост и помощь в наращивании костей и мускулов. Естественный уровень гормона роста колеблется в течение дня, по-видимому, под влиянием физической активности. Например, уровень повышается, когда мы тренируемся.


Уровни гормона роста повышаются в детстве и достигают пика в период полового созревания. На этой фазе развития гормон роста способствует росту костей и хрящей. На протяжении всей жизни гормон роста регулирует жир, мышцы, ткани и кости в нашем организме, а также другие аспекты нашего метаболизма, такие как действие инсулина и уровень сахара в крови.Уровень гормона роста естественным образом снижается начиная со среднего возраста.

Чаще всего врачи назначают синтетический гормон роста, чтобы помочь детям с пониженным уровнем гормонов достичь своего полного роста.

Тем не менее, существует торговля синтетическим гормоном роста на черном рынке, особенно среди спортсменов, бодибилдеров и тех, чей положительный образ тела зависит от мускулистости. Эти люди могут принимать гормон роста (в сочетании с другими веществами для наращивания мышечной массы), ошибочно полагая, что он повысит их мышечную силу.Однако любое улучшение мышечной силы на самом деле связано с другими веществами для наращивания мышц, такими как стероиды.

Как работает гормон роста

Наши кости нуждаются в достаточном количестве гормона роста в детстве и юности, чтобы увеличиться до взрослых размеров. Гормон роста побуждает нашу печень вырабатывать вещество, называемое инсулиноподобным фактором роста (IGF-1). Это и другие подобные соединения участвуют в росте костей.

Гормон роста для детей

Некоторым детям не хватает естественного гормона роста, чтобы вырасти до полного роста.Прием синтезированного гормона роста может помочь им достичь полного роста. Например, детям могут назначать гормон роста человека в случаях плохого роста из-за дефицита гормона роста, синдрома Тернера и почечной недостаточности. Однако исследования показывают, что ребенок с нормальным уровнем гормона роста, принимающий синтезированный вариант, не будет вырастают выше, чем они были бы естественным образом, если только они не принимают очень большие количества. Детям, у которых наблюдается задержка роста или замедленный рост, медицинские работники должны проверить их естественный уровень гормона роста, прежде чем им назначат какие-либо лекарства от их состояния.

Гормон роста для взрослых с дефицитом гормона роста

Взрослые с дефицитом гормона роста (который может быть результатом проблем с гипофизом или гипоталамусом) могут иметь следующие симптомы:

  • низкая плотность костей (что может привести к остеопорозу при отсутствии лечения)
  • снижение мышечной массы
  • усталость
  • депрессия
  • плохая память
  • увеличение жировых отложений вокруг талии.

Им может быть полезно лечение инъекциями гормона роста, которые могут помочь:

  • увеличить плотность костей, тем самым предотвращая переломы
  • увеличить мышечную массу
  • повысить уровень энергии
  • повысить способность к упражнениям
  • уменьшить жировые отложения
  • снижает риск сердечных заболеваний.

Побочные эффекты от использования гормона роста

Приблизительно одна треть людей, которые принимают синтетический гормон роста, испытывают побочные эффекты. К ним могут относиться:

  • задержка жидкости (что приводит к отекам в руках и ногах)
  • боль в суставах и мышцах
  • синдром запястного канала
  • высокий уровень сахара в крови
  • высокий уровень холестерина.

Акромегалия и гормон роста

Акромегалия — это заболевание, вызванное повышенным уровнем гормона роста, чаще всего в результате опухоли в гипофизе этого человека.Это вызывает необратимое разрастание костей, особенно на лице, руках и ногах. Кожа человека также поражается, становясь толстой, грубой и покрытой волосами. Другие побочные эффекты включают высокое кровяное давление и сердечные заболевания. Если опухоль возникла в детстве, может произойти увеличение роста, ведущее к гигантизму.

Длительное употребление синтетического гормона роста также может вызвать акромегалию, но не гигантизм. Это связано с тем, что взрослый человек не может вырасти выше с помощью синтетического гормона роста.Концы длинных костей (эпифизы) в зрелом скелете у взрослых срастаются. Высокие дозы гормона роста могут только утолщить кости человека, а не удлинить их.

Любое увеличение размера мышц из-за использования синтетического гормона роста на самом деле является результатом увеличения соединительной ткани, которая не влияет на мышечную силу. По этой причине использование синтетического гормона роста не приводит к увеличению мышечной силы. Фактически, в долгосрочной перспективе результатом может быть мышечная слабость (включая слабость сердца).

Болезнь Крейтцфельда-Якоба (CJD) и гормон роста

В прошлом гормон роста, используемый для лечения людей, извлекался при вскрытии из гипофиза умерших людей. В некоторых странах (за исключением Австралии) было обнаружено, что прогрессирующее и неизлечимое заболевание мозга, называемое болезнью Крейтцфельдта-Якоба (БКЯ), которое приводит к слабоумию и смерти, в редких случаях передается этим методом.

В настоящее время используется синтетический гормон роста, и риск CJD отсутствует.

Другие химические вещества, используемые для увеличения размера мышц

Некоторые спортсмены или бодибилдеры, которые злоупотребляют гормоном роста в попытке увеличить размер и силу мышц, также используют другие лекарства или запрещенные препараты для ускорения своей физической трансформации. Опасности смешивания этих различных химикатов полностью не известны.

Некоторые из веществ, которые могут употреблять люди, включают:

  • стероиды — синтетические версии мужского полового гормона тестостерона. Они наращивают мышечную ткань и способствуют быстрому восстановлению
  • амфетаминов — для помощи в потере жира
  • бета-блокаторов — для противодействия дрожанию, частому побочному эффекту стероидов
  • диуретиков — для противодействия задержке жидкости (заставляя человека мочиться).

Лечение злоупотребления синтетическим гормоном роста

Отказ от синтетического гормона роста может быть чрезвычайно трудным для взрослых, чей положительный образ тела зависит от того, насколько крупный и мускулистый выглядит. Некоторые пользователи продолжают принимать гормон, даже если он влияет на их здоровье и самочувствие.

Консультации могут помочь вам отказаться от использования синтетического гормона роста. Обратитесь к своему врачу за информацией и направлениями или обратитесь в службу по борьбе с алкоголем и наркотиками в вашем районе.

Где получить помощь

  • Ваш врач
  • Эндокринолог
  • Служба по лечению алкоголя и других наркотиков
  • DirectLine Tel 1800 888 236 — для круглосуточных конфиденциальных консультаций по алкоголю и другим наркотикам, информации и направления
  • Австралийский фонд гипофиза тел. 1300 331 807

Гормон роста — лучший канал здоровья

Гипофиз — это структура в нашем мозгу, которая вырабатывает различные типы специализированных гормонов, включая гормон роста (также называемый гормоном роста человека или HGH).Роль гормона роста включает в себя влияние на наш рост и помощь в наращивании костей и мускулов. Естественный уровень гормона роста колеблется в течение дня, по-видимому, под влиянием физической активности. Например, уровень повышается, когда мы тренируемся.


Уровни гормона роста повышаются в детстве и достигают пика в период полового созревания. На этой фазе развития гормон роста способствует росту костей и хрящей. На протяжении всей жизни гормон роста регулирует жир, мышцы, ткани и кости в нашем организме, а также другие аспекты нашего метаболизма, такие как действие инсулина и уровень сахара в крови.Уровень гормона роста естественным образом снижается начиная со среднего возраста.

Чаще всего врачи назначают синтетический гормон роста, чтобы помочь детям с пониженным уровнем гормонов достичь своего полного роста.

Тем не менее, существует торговля синтетическим гормоном роста на черном рынке, особенно среди спортсменов, бодибилдеров и тех, чей положительный образ тела зависит от мускулистости. Эти люди могут принимать гормон роста (в сочетании с другими веществами для наращивания мышечной массы), ошибочно полагая, что он повысит их мышечную силу.Однако любое улучшение мышечной силы на самом деле связано с другими веществами для наращивания мышц, такими как стероиды.

Как работает гормон роста

Наши кости нуждаются в достаточном количестве гормона роста в детстве и юности, чтобы увеличиться до взрослых размеров. Гормон роста побуждает нашу печень вырабатывать вещество, называемое инсулиноподобным фактором роста (IGF-1). Это и другие подобные соединения участвуют в росте костей.

Гормон роста для детей

Некоторым детям не хватает естественного гормона роста, чтобы вырасти до полного роста.Прием синтезированного гормона роста может помочь им достичь полного роста. Например, детям могут назначать гормон роста человека в случаях плохого роста из-за дефицита гормона роста, синдрома Тернера и почечной недостаточности. Однако исследования показывают, что ребенок с нормальным уровнем гормона роста, принимающий синтезированный вариант, не будет вырастают выше, чем они были бы естественным образом, если только они не принимают очень большие количества. Детям, у которых наблюдается задержка роста или замедленный рост, медицинские работники должны проверить их естественный уровень гормона роста, прежде чем им назначат какие-либо лекарства от их состояния.

Гормон роста для взрослых с дефицитом гормона роста

Взрослые с дефицитом гормона роста (который может быть результатом проблем с гипофизом или гипоталамусом) могут иметь следующие симптомы:

  • низкая плотность костей (что может привести к остеопорозу при отсутствии лечения)
  • снижение мышечной массы
  • усталость
  • депрессия
  • плохая память
  • увеличение жировых отложений вокруг талии.

Им может быть полезно лечение инъекциями гормона роста, которые могут помочь:

  • увеличить плотность костей, тем самым предотвращая переломы
  • увеличить мышечную массу
  • повысить уровень энергии
  • повысить способность к упражнениям
  • уменьшить жировые отложения
  • снижает риск сердечных заболеваний.

Побочные эффекты от использования гормона роста

Приблизительно одна треть людей, которые принимают синтетический гормон роста, испытывают побочные эффекты. К ним могут относиться:

  • задержка жидкости (что приводит к отекам в руках и ногах)
  • боль в суставах и мышцах
  • синдром запястного канала
  • высокий уровень сахара в крови
  • высокий уровень холестерина.

Акромегалия и гормон роста

Акромегалия — это заболевание, вызванное повышенным уровнем гормона роста, чаще всего в результате опухоли в гипофизе этого человека.Это вызывает необратимое разрастание костей, особенно на лице, руках и ногах. Кожа человека также поражается, становясь толстой, грубой и покрытой волосами. Другие побочные эффекты включают высокое кровяное давление и сердечные заболевания. Если опухоль возникла в детстве, может произойти увеличение роста, ведущее к гигантизму.

Длительное употребление синтетического гормона роста также может вызвать акромегалию, но не гигантизм. Это связано с тем, что взрослый человек не может вырасти выше с помощью синтетического гормона роста.Концы длинных костей (эпифизы) в зрелом скелете у взрослых срастаются. Высокие дозы гормона роста могут только утолщить кости человека, а не удлинить их.

Любое увеличение размера мышц из-за использования синтетического гормона роста на самом деле является результатом увеличения соединительной ткани, которая не влияет на мышечную силу. По этой причине использование синтетического гормона роста не приводит к увеличению мышечной силы. Фактически, в долгосрочной перспективе результатом может быть мышечная слабость (включая слабость сердца).

Болезнь Крейтцфельда-Якоба (CJD) и гормон роста

В прошлом гормон роста, используемый для лечения людей, извлекался при вскрытии из гипофиза умерших людей. В некоторых странах (за исключением Австралии) было обнаружено, что прогрессирующее и неизлечимое заболевание мозга, называемое болезнью Крейтцфельдта-Якоба (БКЯ), которое приводит к слабоумию и смерти, в редких случаях передается этим методом.

В настоящее время используется синтетический гормон роста, и риск CJD отсутствует.

Другие химические вещества, используемые для увеличения размера мышц

Некоторые спортсмены или бодибилдеры, которые злоупотребляют гормоном роста в попытке увеличить размер и силу мышц, также используют другие лекарства или запрещенные препараты для ускорения своей физической трансформации. Опасности смешивания этих различных химикатов полностью не известны.

Некоторые из веществ, которые могут употреблять люди, включают:

  • стероиды — синтетические версии мужского полового гормона тестостерона. Они наращивают мышечную ткань и способствуют быстрому восстановлению
  • амфетаминов — для помощи в потере жира
  • бета-блокаторов — для противодействия дрожанию, частому побочному эффекту стероидов
  • диуретиков — для противодействия задержке жидкости (заставляя человека мочиться).

Лечение злоупотребления синтетическим гормоном роста

Отказ от синтетического гормона роста может быть чрезвычайно трудным для взрослых, чей положительный образ тела зависит от того, насколько крупный и мускулистый выглядит. Некоторые пользователи продолжают принимать гормон, даже если он влияет на их здоровье и самочувствие.

Консультации могут помочь вам отказаться от использования синтетического гормона роста. Обратитесь к своему врачу за информацией и направлениями или обратитесь в службу по борьбе с алкоголем и наркотиками в вашем районе.

Где получить помощь

  • Ваш врач
  • Эндокринолог
  • Служба по лечению алкоголя и других наркотиков
  • DirectLine Tel 1800 888 236 — для круглосуточных конфиденциальных консультаций по алкоголю и другим наркотикам, информации и направления
  • Австралийский фонд гипофиза тел. 1300 331 807

Дефицит гормона роста | Бостонская детская больница

Как следует из названия, дефицит гормона роста возникает, когда гипофиз не производит достаточного количества гормона роста, чтобы стимулировать рост организма.Это может привести к заметному низкому росту у детей.

  • Дефицит гормона роста может быть частичным (гипофиз вырабатывает недостаточное количество гормона роста) или полным (гипофиз не производит гормона роста).
  • Дефицит гормона роста может возникнуть в младенчестве или позже в детстве.
  • Примерно один из 4000–10 000 детей страдает дефицитом гормона роста.
  • При раннем выявлении и лечении многие из этих детей могут достичь нормального роста.

Каковы симптомы дефицита гормона роста?

Поскольку рост происходит в течение многих лет, и поскольку дети растут с разной скоростью, симптомы дефицита гормона роста может быть трудно выявить. Помимо заметно медленного роста при нормальных пропорциях тела, к признакам могут относиться:

  • незрелый внешний вид, по сравнению с аналогами
  • пухлое телосложение
  • лоб выпуклый
  • недоразвитая переносица

Дефицит гормона роста не влияет на интеллект ребенка.

Эти симптомы могут напоминать другие состояния, поэтому обязательно консультируйтесь с врачом вашего ребенка для постановки диагноза.

Как вы определяете «нормальный» рост?

Темпы роста значительно различаются от ребенка к ребенку. Но измеренный по высоте средний «нормальный» рост часто описывается как:

  • 0-12 месяцев: около 10 дюймов в год
  • 1-2 года: около 5 дюймов в год
  • 2-3 ​​года: около 3½ дюймов в год
  • 3 года до полового созревания: от 2 до 2,5 дюймов в год

Если рост вашего ребенка ниже третьего процентиля для ребенка его возраста, это может быть красным флажком для дефицита гормона роста.

Что вызывает дефицит гормона роста?

Повреждение гипофиза или гипоталамуса может быть результатом аномального образования, которое произошло до рождения вашего ребенка (врожденное), или чего-то, что произошло во время или после рождения (приобретенное).

Врожденная недостаточность гормона роста может возникнуть при наличии мутаций в генах факторов, которые важны для развития гипофиза, или в рецепторах и факторах (включая гормон роста) на пути гормона роста; однако на сегодняшний день причина большинства этих случаев неизвестна.

К приобретенным причинам дефицита гормона роста относятся:

  • опухоль головного мозга в гипоталамусе или гипофизе
  • травма головы
  • лучевая терапия онкологических заболеваний, если область лечения включает гипоталамус и гипофиз
  • заболеваний, которые проникают в гипоталамус или его связь с гипофизом, например гистиоцитоз
  • аутоиммунное заболевание (лимфоцитарный гипофизит)

Также важно помнить, что дефицит гормона роста — лишь одно из многих условий, которые могут повлиять на рост вашего ребенка.Низкий рост вашего ребенка может быть вызван другими синдромами, а задержка роста может быть связана с пониженным потреблением пищи, желудочно-кишечными расстройствами, заболеваниями, требующими повышенного метаболизма, или гипотиреозом.

Каковы осложнения дефицита гормона роста?

Некоторые исследования показывают, что дефицит гормона роста может вызвать дополнительные осложнения, в том числе:

  • снижение минеральной плотности костей
  • Повышенные факторы риска сердечно-сосудистых заболеваний
  • пониженный уровень энергии

Вопросы к врачу

Вы и ваша семья — ключевые игроки в оказании медицинской помощи вашему ребенку.Важно, чтобы вы делились своими наблюдениями и идеями с лечащим врачом вашего ребенка и понимали его рекомендации.

Если у вашего ребенка симптомы дефицита гормона роста и вы записались на прием, у вас, вероятно, уже есть некоторые идеи и вопросы. Но на приеме можно легко забыть вопросы, которые вы хотели задать. Часто бывает полезно записать их заранее, чтобы вы могли покинуть встречу с ощущением, что у вас есть необходимая информация.

Если ваш ребенок достаточно взрослый, вы можете предложить ему записать то, о чем он хочет спросить своего врача.

Вот некоторые из вопросов, которые вы можете задать:

  • Что вызывает дефицит гормона роста у моего ребенка?
  • Будете ли вы назначать заместительную терапию гормоном роста?
  • Есть ли побочные эффекты или потенциально опасные риски для лечения?
  • Как долго мой ребенок должен будет продолжать принимать лекарства?
  • Насколько я могу ожидать, что мой ребенок вырастет?

Как Бостонская детская больница приближается к дефициту гормона роста

Мы рассматриваем диагностику дефицита гормона роста как важный первый шаг к лечению и, в конечном итоге, к долгосрочному здоровью и продолжению роста вашего ребенка.Вы можете не сомневаться, зная, что ваш ребенок находится в надежных руках.

В наш отзывчивый персонал входят врачи-специалисты, имеющие опыт в оценке, диагностике и лечении дефицита гормона роста. И мы обладаем уникальной квалификацией, чтобы определить лучший способ ухода за вашим ребенком. Наш подход, ориентированный на ребенка, гарантирует, что мы будем заботиться о вашем ребенке как о ребенке , а не просто о другом пациенте.

Поскольку цепь событий, связанных с дефицитом гормона роста, очень сложна, наши исследователи исследуют различные события, которые могут привести к низкорослости ребенка.Не все эти индивидуальные дефекты хорошо изучены или легко обнаруживаются с помощью теста, что делает это исследование жизненно важным для стратегий лечения.

Наше отделение эндокринологии — один из ведущих мировых центров по уходу за детьми и подростками с острыми и хроническими эндокринными и метаболическими нарушениями. Для детей, страдающих проблемами роста, наша преданная команда врачей, медсестер и других лиц, осуществляющих уход, дает надежду на более здоровое будущее.

Дефицит гормона роста | Диагностика и лечение

Как мы диагностируем дефицит гормона роста

Первый шаг в лечении вашего ребенка — это постановка точного и полного диагноза.Прежде чем поставить диагноз дефицита гормона роста, врачу вашего ребенка, возможно, придется сначала исключить другие расстройства, в том числе генетический низкий рост (унаследованную семейную коротышку), недостаточное потребление калорий, дефицит гормона щитовидной железы и другие заболевания, включая проблемы с желудочно-кишечным трактом.

В дополнение к изучению полной истории болезни вашего ребенка, сбору информации о росте и любых проблемах со здоровьем ваших родственников, а также к проведению медицинского обследования, врач вашего ребенка может:

  • отслеживайте рост вашего ребенка в течение определенного периода времени
  • проверить беременность, роды и роды матери
  • возьмите небольшое количество крови для поиска признаков других заболеваний
  • организовать рентген кисти и запястья вашего ребенка (для сравнения развития костей с хронологическим возрастом и определения потенциала роста)
  • измеряет количество инсулиноподобного фактора роста-1 (IGF-1) и белка, связывающего инсулиноподобный фактор роста-3 (IGFBP-3) в крови, которые вырабатываются при стимуляции печени и других тканей гормоном роста

Поскольку гормон роста вырабатывается импульсами, маловероятно, что какой-либо отдельный образец крови позволит поставить окончательный диагноз.

Если есть подозрение на дефицит гормона роста, ваш врач может использовать стимулятор секреции гормона роста (который может включать в себя энергичные упражнения и / или несколько химикатов и лекарств) и измерить высвобождение гормона роста с течением времени.

Если диагностирована недостаточность гормона роста, ваш врач может назначить МРТ головного мозга для исследования гипоталамуса и гипофиза.

После того, как мы завершим все необходимые тесты, наши специалисты встречаются, чтобы проанализировать и обсудить то, что они узнали о состоянии вашего ребенка.Затем мы встретимся с вами и вашей семьей, чтобы обсудить результаты и наметить лучшие варианты лечения.

В настоящее время исследователи работают над более эффективными и точными способами диагностики дефицита гормона роста.

Как мы лечим дефицит гормона роста

Наши врачи специализируются на уходе за детьми, и мы известны своим научно-ориентированным подходом. Наши опытные врачи знают, что дефицит гормона роста — это сложная проблема, которая может принимать разные формы от пациента к пациенту.Такое индивидуализированное заболевание может потребовать нескольких тщательных диагностических тестов и лечения, специально разработанного для вашего ребенка.

Обычно лечение дефицита гормона роста включает регулярные инъекции синтетического гормона роста человека, а детям — ежедневные инъекции. Лечение обычно длится несколько лет, хотя результаты часто видны уже через три-четыре месяца после начала инъекций.

Чем раньше будет начато лечение дефицита гормона роста, тем больше шансов, что ребенок достигнет своего нормального или почти нормального взрослого роста.Однако не все дети хорошо поддаются лечению гормоном роста.

Детей, у которых есть мутации, из-за которых их клетки перестают реагировать на гормон роста, можно лечить с помощью инъекций синтетического человеческого IGF-1.

  • Эти инъекции предназначены для очень коротких пациентов с очень низким уровнем IGF-1, которые прошли тестирование на стимуляцию гормона роста.

Американская академия педиатрии (AAP) рекомендует, чтобы терапия гормоном роста была приемлемой с медицинской и этической точки зрения для детей:

  • с классической недостаточностью гормона роста
  • в ожидании трансплантации почки с хронической почечной недостаточностью
  • с синдромом Тернера (женщины)
  • , чей чрезвычайно низкий рост не позволяет им участвовать в повседневной деятельности и у которых есть состояние, при котором терапия гормоном роста будет полезна

Насколько безопасно лечение дефицита гормона роста?

Хотя существует множество потенциальных побочных эффектов, особенно если гормон роста используется для лечения детей, у которых нет истинного гормонального дефицита, исследователи в целом согласны с тем, что лечение гормоном роста человека безопасно и эффективно.В 1985 году Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) одобрило биосинтетический гормон роста, таким образом:

  • устраняет риск передачи заболеваний от гормона роста человека (ранее единственным источником этого гормона был гипофиз умершего)
  • создает неограниченный запас гормона

За дополнительной информацией обращайтесь к лечащему врачу вашего ребенка.

Дефицит гормона роста может привести к тому, что ваш ребенок будет чувствовать себя неуверенно или застенчиво, и при необходимости мы также можем связать вас со специалистами в области психического здоровья, чтобы помочь с любыми негативными переживаниями, которые может испытывать ваш ребенок.

Копирование и опора

Мы понимаем, что у вас может возникнуть много вопросов, если вашему ребенку поставлен диагноз дефицит гормона роста. Как это повлияет на моего ребенка в долгосрочной перспективе? Что мы делаем дальше? Мы попытались дать некоторые ответы на эти вопросы на этом сайте, но есть также ряд других ресурсов, которые помогут вам и вашей семье в диагностике и лечении.

Обучение пациентов : С первого визита в офис наши медсестры будут рядом, чтобы рассказать вам о лечении вашего ребенка и помочь ответить на любые ваши вопросы — Что такое лечение? Есть ли побочные эффекты? Они также свяжутся с вами по телефону, чтобы продолжить уход и поддержку, которые вы получали во время пребывания в Children’s.

От родителей к родителям : Хотите поговорить с кем-нибудь, чей ребенок лечился от дефицита гормона роста? Мы часто можем связать вас с другими семьями, которые поделятся своим опытом.

Социальная работа: Наши социальные работники и психиатры помогли многим другим семьям в вашей ситуации. Ваш социальный работник может предложить консультации и помощь в решении таких вопросов, как стрессы, связанные с маленьким ростом, решение проблемы с диагнозом дефицита гормона роста вашего ребенка и решение финансовых трудностей.

На наших страницах ресурсов для пациентов вы можете прочитать все, что вам нужно знать о:

Гормон роста регулирует нейроэндокринные ответы на потерю веса через нейроны AgRP

Мыши

Чтобы вызвать генетическое устранение GHR, мышей, несущих loxP-фланкированные аллели Ghr 44 , скрещивали с мышами AgRP-IRES-Cre (Agrp tm1 (cre) Lowl / J, Лаборатория Джексона), мышь LepR-IRES-Cre (B6.129-Lepr tm2 (cre) Rck / J, Лаборатория Джексона) или мышь Nestin-Cre (B6.Cg-Tg (Nes-cre) 1Kln / J, Лаборатория Джексона). Контрольные мыши были гомозиготными по аллелю Ghr , фланкированному loxP, тогда как их однопометники, несущие аллели Cre, считались мышами с условным нокаутом. В некоторых гистологических и электрофизиологических экспериментах мышей AgRP-IRES-Cre или LepR-IRES-Cre также скрещивали с Cre-индуцибельной tdTomato-репортерной мышью (B6; 129S6-Gt (ROSA) 26Sor tm9 (CAG-tdTomato) Hze ). / J, The Jackson Laboratory), что позволяет визуализировать нейроны AgRP или LepR посредством экспрессии флуоресцентного белка tdTomato.Мыши этих линий находились на фоне C57BL / 6. Мышей отлучили от груди в возрасте 3-4 недель, и их мутации были подтверждены генотипированием ДНК, которая была ранее извлечена из кончика хвоста (REDExtract-N-Amp ™ Tissue PCR Kit, Sigma). Генетически модифицированные модели мышей и мышей C57BL / 6 дикого типа получали и содержали в стандартных условиях освещения (12-часовой цикл свет / темнота) и температуры (22 ± 1 ° C). Мыши получали обычную диету для грызунов (2,99 ккал / г; 9,4% калорий из жира).Все эксперименты проводились в соответствии с руководящими принципами Национального института здоровья (NIH) по уходу и использованию лабораторных животных и ранее были одобрены Комитетом по этике использования животных Института биомедицинских наук Университета Сан-Паулу. .

Гистология головного мозга

Для визуализации GH-чувствительных клеток в головном мозге взрослым мышам ( n = 3–4 / группа) вводили острый i.p. инъекция GH гипофиза свиньи (pGH; 20 мкг / г, от Dr.A.F. Parlow, Национальная программа по гормонам и пептидам (NHPP), Национальный институт диабета, болезней органов пищеварения и почек), и через 90 минут была проведена перфузия. Для оценки индуцированной голоданием экспрессии c-Fos в ARH контрольным мышам и мышам AgRP GHR KO, несущим Cre-индуцибельный репортерный белок tdTomato ( n = 5 / группа), перфузировали через 24 часа голодания. Грелин-индуцированную экспрессию c-Fos измеряли у контрольных мышей и мышей AgRP GHR KO ( n = 4–5 / группа) перфузировали через 90 минут после подкожной инъекции грелина (0.2 мкг / г массы тела (b.w.), Global Peptide, cat. нет. C-et-004). Для перфузии мышей подвергали глубокой анестезии изофлураном и транскардиально перфузировали физиологическим раствором, а затем 10% забуференным раствором формалина (150–200 мл на мышь). Мозг собирали и после фиксировали в том же фиксаторе в течение 30–60 мин и подвергали криозащите в течение ночи при 4 ° C в 0,1 M PBS, содержащем 20% сахарозы, pH 7,4. Мозг вырезали (срезы толщиной 30 мкм) во фронтальной плоскости с помощью замораживающего микротома. Для маркировки pSTAT5 срезы мозга промывали 0.02 M PBS калия, pH 7,4 (KPBS), с последующей предварительной обработкой в ​​щелочном (pH> 13) водном растворе, содержащем 1% перекиси водорода и 1% гидроксида натрия, в течение 20 мин. После промывания в KPBS срезы инкубировали в 0,3% глицине и 0,03% лаурилсульфате в течение 10 минут каждый. Затем срезы блокировали в 3% нормальной ослиной сыворотке в течение 1 часа с последующей инкубацией с первичным антителом против pSTAT5 Tyr694 (1: 1000; Cell Signaling; # 9351) в течение 40 часов. Для реакции иммунофлуоресценции срезы промывали в KPBS и инкубировали в течение 90 мин во вторичных антителах, конъюгированных с AlexaFluor 488 (1: 500, Jackson Laboratories).Срезы помещали на покрытые желатином предметные стекла, и на предметные стекла наносили покровное стекло Fluoromount G (Electron Microscopic Sciences, Hatfield, PA). Для окрашивания иммунопероксидазой срезы инкубировали в течение 1 ч в конъюгированном с биотином вторичном антителе (1: 1000, Jackson Laboratories), а затем в течение 1 ч с комплексом авидин-биотин (1: 500, Vector Labs). Пероксидазную реакцию проводили с использованием 0,05% 3,3’-диаминобензидина, 0,25% сульфата никеля и 0,03% перекиси водорода, что приводило к окрашиванию ядер в черный цвет.Слайды закрывали установочной средой DPX (Sigma, Сент-Луис, Миссури). Реакция на метку c-Fos была аналогична протоколу pSTAT5, за исключением того, что срезы мозга инкубировали с антителом против c-Fos (1:20 000, Ab5, Millipore) в течение 48 часов. Микрофотографии получали с помощью камеры Zeiss Axiocam HRc, соединенной с микроскопом Zeiss Axioimager A1 (Zeiss, Мюнхен, Германия). Изображения были оцифрованы с использованием программного обеспечения Axiovision (Zeiss). Программное обеспечение ImageJ Cell Counter (http://rsb.info.nih.gov/ij/) использовалось для ручного подсчета количества клеток в интересующих областях.

Электрофизиология

Чтобы изучить острые эффекты GH на возбудимость мембраны нейронов AgRP, были выполнены записи цельноклеточных патч-кламп на срезах гипоталамуса самцов мышей-репортеров AgRP (возраст 8–12 недель). Мышей декапитировали, их мозг собирали и немедленно погружали в ледяную, насыщенную карбогенами (95% O 2 и 5% CO 2 ) искусственную спинномозговую жидкость (aCSF; 124 мМ NaCl, 2,8 мМ KCl, 26 мМ NaHCO 3 , 1,25 мМ NaH 2 PO 4 , 1.2 мМ MgSO 4 , 5 мМ глюкозы и 2,5 мМ CaCl ( 2 ). Корональные срезы (толщиной 250 мкМ) из гипоталамического блока вырезали с помощью вибратома Leica VT1000S, а затем инкубировали в насыщенном кислородом aCSF при комнатной температуре в течение не менее 1 часа перед записью. Срезы переносили в записывающую камеру и давали уравновеситься в течение 10–20 мин перед записью. Срезы погружали в насыщенный кислородом CSF (30 ° C) при скорости потока 2 мл / мин. В режиме фиксации тока для нормализации мембранного потенциала использовалась инжекция тока (<± 8 пА).Мембранный потенциал покоя контролировали в течение не менее 5 минут (базальный), после чего в ванну добавляли pGH (5 мкг / мл) в течение примерно 5 минут. Частоту потенциалов действия определяли путем анализа скорости возбуждения за 2 минуты непосредственно перед введением pGH и в течение последних 2 минут применения лекарства. Изменения мембранного потенциала покоя также оценивали в присутствии ТТХ (1 мкМ) и синаптических блокаторов (CNQX при 10 мкМ, AP-5 при 50 мкМ и пикротоксин при 50 мкМ). Значения мембранного потенциала были скомпенсированы с учетом потенциала перехода (-8 мВ).

Оценка гомеостаза энергии и глюкозы

Еженедельно контролировали массу тела мышей AgRP GHR KO, LepR GHR KO и головного мозга GHR KO, а также их соответствующих контрольных животных. Когда мышей достигали возраста примерно 20 недель, их содержали по одному и ежедневно измеряли потребление пищи в течение 5-7 дней подряд. Затем мышей подвергали тесту на толерантность к глюкозе (2 г глюкозы / кг веса тела; внутрибрюшинно) и тесту на толерантность к инсулину (1 МЕ инсулина / кг веса тела; внутрибрюшинно). Чтобы определить потребление O 2 (расход энергии), производство CO 2 , коэффициент дыхательного обмена и двигательную активность (с помощью датчиков инфракрасного луча), мышей помещали в Oxymax / Комплексную лабораторную систему мониторинга животных (CLAMS; Columbus Instruments, Columbus). , Огайо, США).После 3-дневного периода адаптации внутри CLAMS эти метаболические параметры оценивались в течение 4 дней подряд. Таким образом, представленные результаты были средними за этот период. Общий вес тела и безжировую массу измеряли с помощью ядерного магнитного резонанса во временной области (TD-ЯМР) с использованием анализатора состава тела мышей LF50 (Bruker, Германия). Ожирение также определяли путем суммирования веса перигонадальных, подкожных и забрюшинных жировых подушечек. Для определения роста тела оценивали длину носа-ануса.

Чувствительность к лептину и грелину

Для оценки чувствительности к лептину мышам вводили i.p. инъекция либо PBS, либо рекомбинантного лептина мыши (2,5 мкг / г м.т .; от доктора A.F. Parlow, NHPP, США) за 3 часа до наступления темноты, а потребление пищи регистрировали через 4, 14 и 24 часа после инъекции. Прием пищи после инъекции PBS сравнивали с приемом пищи после введения лептина. Орексигенный ответ на грелин определяли у мышей, которым подкожно вводили PBS или грелин (0.2 мкг / г м.т., Global Peptide, кат. нет. C-et-004). Прием пищи оценивали через 60 мин после инъекций.

Метаболические эффекты, вызванные ограничением пищи

Для исследования нейроэндокринных и метаболических изменений, вызванных потерей веса, мышей первоначально содержали по одному и регистрировали их потребление пищи. Затем мышей подвергали 60% ограничению в еде, по которому каждая мышь получала 40% от своего нормального потребления за 2 часа до выключения света на 5-7 дней подряд. В течение этого периода метаболические параметры постоянно оценивались с помощью CLAMS, а их масса тела, состав тела (с помощью TD-ЯМР) и гликемия отслеживались во время подачи пищи.Ежедневный расчет VO 2 учитывал изменения массы тела во время ограничения пищи, чтобы получить значение относительно массы тела (мл / кг / ч). Затем изменения в потреблении кислорода (расходе энергии) во время ограничения в пище регистрировались как процент от значений, полученных по сравнению с исходным уровнем (обычно записи за 2-3 дня до ограничения в пище). Кроме того, подгруппы взрослых (примерно 12-недельного возраста) контрольных мышей и мышей AgRP GHR KO были убиты в начале светового цикла (8:00 утра) на второй день ограничения пищи.Одновременно умерщвляли мышей с неограниченным доступом к пище. Гипоталамус, межлопаточная летучая мышь и ствол крови собирали для последующих анализов.

Медикаментозное лечение во время ограничения питания

Взрослых мышей-самцов C57BL / 6 дикого типа подвергали тому же протоколу 60% ограничения в питании, описанному ранее, за исключением того, что они получали лечение дважды в день (в 9:00 и 18:00; светится в 8:00 утра) ip инъекции рекомбинантного лептина мыши (2,5 мкг / г м.т. на инъекцию; NHPP, США), антагониста человеческого GHR (пегвисомант; 20 мкг / г b.ш. за инъекцию; Сомаверт ® ; Pfizer, Inc.) или контрольный раствор (разбавитель пегвисомант). Изменения в расходе энергии и массе тела, вызванные голоданием, оценивали, как описано ранее.

Метаболические эффекты, вызванные гипогликемией

Чтобы вызвать контррегуляторный ответ на гипогликемию, мыши получали i.p. инъекция 2DG (0,5 мг / кг м.т .; Sigma). Первоначально мы оценивали влияние 2DG на гликемию в течение 180 минут. Затем мыши получали i.p. инъекции PBS или 2DG и их потребление пищи регистрировали через 2, 3 и 4 часа после этого.

Измерения гормонов

Имеющиеся в продаже наборы для твердофазного иммуноферментного анализа (ELISA) использовали для определения сывороточной концентрации лептина (Crystal Chem), T4 (Calbiotech), тестостерона (Calbiotech), кортикостерона (Arbor Assays), GH (Millipore). ), IGF-1 (R&D Systems) и пролактин (Sigma).

Анализ экспрессии гена

Суммарную РНК из гипоталамуса или межлопаточных BAT экстрагировали с помощью реагента TRIzol (Invitrogen). Оценку количества и качества РНК проводили с помощью микропланшетного спектрофотометра Epoch (Biotek).Тотальную РНК инкубировали в среде, не содержащей РНКазы ДНКазы I (Roche Applied Science). Обратную транскрипцию выполняли с 2 мкг общей РНК с помощью обратной транскриптазы SuperScript II (Invitrogen) и случайных праймеров p (dN) 6 (Roche Applied Science). Полимеразную цепную реакцию в реальном времени проводили с использованием системы ПЦР в реальном времени 7500TM (Applied Biosystems) и Power SYBR Green PCR Master Mix (Applied Biosystems). Относительное количественное определение мРНК рассчитывали по 2 -ΔΔCt . Данные были нормализованы к среднему геометрическому значению β-актина, глицеральдегид-3-фосфатдегидрогеназы (GAPDH) и циклофилина А и представлены как кратные изменения по сравнению со значениями, полученными в контрольной группе (установлено на 1.0). Были использованы следующие праймеры: AgRP (прямой: ctttggcggaggtgctagat; обратный: aggactcgtgcagccttacac), β-актин (прямой: gctccggcatgtgcaaag; обратный: catcacaccctggtgccta), циклофилин A (вперед: tatggcggcactgtctg; tacggccaaatccgttcaca), GHR (вперед: atcaatccaagcctggggac; обратное: acagctgaatagatcctgggg), GHRH (вперед: tatgcccggaaagtgatccag; обратное: atccttgggaatccctgcaaga), NPY (вперед: cagatactactccgctctgcg; обратное: gggctggatctcttgccata), РОМС (вперед: tagatgtgtggagctggtgc; обратное: ccagcgagaggtcgagtttg) и ОГП-1 (вперед: gaggtgtggcagtgttcattg; назад: ggcttgcattctgaccttca).

Статистический анализ

Все результаты выражены как среднее ± стандартное отклонение. Парный двусторонний тест Стьюдента t использовали для сравнения эффектов введения GH или носителя у одних и тех же животных, а также в электрофизиологических данных (до и во время применения GH). Непарный двусторонний критерий Стьюдента t использовался для сравнения между двумя группами. Когда три группы сравнивались одновременно, мы использовали односторонний дисперсионный анализ (ANOVA) и тесты множественного сравнения Ньюмана – Кеулса.Данные были проанализированы с использованием двухфакторного дисперсионного анализа (ANOVA), когда это было необходимо, с последующими апостериорными тестами Ньюмана-Кеулса или Фишера по методу наименьшего значимого различия (LSD). Статистический анализ проводили с использованием программного обеспечения GraphPad Prism. Мы считали значений P <0,05 статистически значимыми.

Сводка отчетов

Дополнительная информация о дизайне экспериментов доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Время для общего одобрения лечения гормоном роста взрослых с синдромом Прадера – Вилли | Журнал редких заболеваний Орфанета

  • 1.

    Damen L, Donze SH, Kuppens RJ, Bakker NE, de Graaff LCG, van der Velden AEM, Hokken-Koelega ACS. Три года лечения гормоном роста молодых людей с синдромом Прадера-Вилли: устойчивое положительное влияние на композицию тела. Orphanet J Rare Dis. 2020; 15: 163. https://doi.org/10.1186/s13023-020-01440-6.

    Артикул PubMed PubMed Central Google ученый

  • 2.

    Дрисколл Д.Д., Миллер Д.Л., Шварц С. и др. Синдром Прадера-Вилли.6 октября 1998 г. [Обновлено 14 декабря 2017 г.]. В: Адам М.П., ​​Ардингер Х.Х., Пагон Р.А. и др., Редакторы. GeneReviews® [Интернет]. Сиэтл (Вашингтон): Вашингтонский университет, Сиэтл; 1993–2020 гг. https://www.ncbi.nlm.nih.gov/books/NBK1330/

  • 3.

    Goldstone AP, Holland AJ, Hauffa BP et al. Рекомендации по диагностике и лечению синдрома Прадера – Вилли. J Clin Endocrinol Metab. 2008; 93: 4183–97.

    CAS Статья Google ученый

  • 4.

    Miller JL, Lynn CH, Driscoll DC, et al. Фазы питания при синдроме Прадера – Вилли. Am J Med Genet. 2011; 155A (5): 1040–9.

    Артикул Google ученый

  • 5.

    Флезериу М., Хашим И.А., Каравитаки Н. и др. Гормональная замена при гипопитуитаризме у взрослых: руководство по клинической практике эндокринного общества. J Clin Endocrinol Metab. 2016; 101: 3888.

    CAS Статья Google ученый

  • 6.

    Deal CL, Тони М., Хойби С. и др. Резюме семинара Общества исследования гормона роста: согласованные руководящие принципы терапии рекомбинантным гормоном роста человека при синдроме Прадера – Вилли. J Clin Endocrinol Metab. 2013; 98 (6): E1072-1087.

    CAS Статья Google ученый

  • 7.

    Grugni G, Sattorio A, Crino A. Терапия гормоном роста при синдроме Прадера – Вилли: проблемы и решения. Ther Clin Risk Manag. 2016; 12: 873–81.

    CAS Статья Google ученый

  • 8.

    Санчес-Ортига Р., Клибански А, Тритос Н.А. Эффекты терапии рекомбинантным гормоном роста человека у взрослых с синдромом Прадера – Вилли: метаанализ. Клин Эндокринол (Oxf). 2012; 77 (1): 86–93.

    CAS Статья Google ученый

  • 9.

    Sode-Carlsen R, Farholt S, Rabben KF, Bollerslev J, Schreiner T., Jurik AG, Frystyk J, Christiansen JS, Höybye C. Двухлетнее лечение гормоном роста безопасно и эффективно у взрослых с препаратом Prader– Синдром Вилли.Гормона роста IGF Res. 2011. 21 (4): 185–90.

    CAS Статья Google ученый

  • 10.

    Höybye C. Пятилетнее лечение гормоном роста (GH) взрослых с синдромом Прадера – Вилли. Acta Paediatr. 2007; 96: 410–3.

    Артикул Google ученый

  • 11.

    Höybye C. Пятнадцать лет лечения гормоном роста мужчин с синдромом Прадера – Вилли. Acta Paediatr. 2015; 104 (4): 422–7.

    Артикул Google ученый

  • 12.

    Kuppens RJ, Bakker NE, Siemensma EP, et al. Положительные эффекты гормона роста у молодых людей с синдромом Прадера – Вилли: двухлетнее перекрестное исследование. J Clin Endocrinol Metab. 2016; 101 (11): 4110–6.

    CAS Статья Google ученый

  • 13.

    Коидзуми М., Ида С., Сёдзи И., Нишимото Ю., Этани Ю., Кавай М. Висцеральная жировая ткань увеличивается вскоре после прекращения терапии гормоном роста у взрослых с синдромом Прадера-Вилли.Эндокр Дж. 2018; 65 (11): 1127–37.

    CAS Статья Google ученый

  • 14.

    Höybye C, Thorén M, Böhm B. Когнитивные, эмоциональные, физические и социальные эффекты лечения гормоном роста у взрослых с синдромом Прадера – Вилли. J Интеллект Disabil Res. 2005: 49–4: 245–52.

    Артикул Google ученый

  • 15.

    Гондони Л.А., Висмара Л., Марзулло П., Веттор Р., Лиуцци А., Груни Г.Терапия гормоном роста улучшает физическую работоспособность у взрослых пациентов с синдромом Прадера – Вилли. J Endocrinol Invest. 2008. 31 (9): 765–72.

    CAS Статья Google ученый

  • 16.

    Lafortuna CL, Minocci A, Capodaglio P, Gondoni LA, Sartorio A, et al. Характеристики скелетных мышц и двигательная способность после 2-летнего лечения гормоном роста у взрослых с синдромом Прадера – Вилли. J Clin Endocrinol Metab. 2014; 99: 1816–24.

    CAS Статья Google ученый

  • 17.

    Donze SH, Kuppens RJ, Bakker NE, van der Velden JAEM, Hokken-Koelega ACS. Минеральная плотность костной ткани у молодых людей с синдромом Прадера – Вилли: рандомизированное плацебо-контролируемое перекрестное исследование GH. Клин Эндокринол (Oxf). 2018; 88 (6): 806–12.

    CAS Статья Google ученый

  • 18.

    Jørgensen AP, Ueland T, Sode-Carlsen R, Schreiner T., Rabben KF, Farholt S, Høybye C., Christiansen JS, Bollerslev J. Два года лечения гормоном роста взрослых с синдромом Прадера-Вилли не дают результатов. улучшить низкую МПК.J Clin Endocrinol Metab. 2013; 98 (4): E753–60.

    Артикул Google ученый

  • 19.

    Bertella L, Mori I, Grugni G, Pignatti R, Ceriani F, Molinari E, Ceccarelli A, Sartorio A, Vettor R, Semenza C. Качество жизни и психологическое благополучие в группе GH, взрослые Пациенты с PWS: продольное исследование. J Интеллект Disabil Res. 2007; 51: 302–11.

    CAS Статья Google ученый

  • 20.
  • Ответить

    Ваш адрес email не будет опубликован. Обязательные поля помечены *